Retrospection, 2006

So many things have happened this year, even if only in my mind ;-), that I can't possibly summarize it into a few paragraphs. It's just beyond my ability. So maybe I'll just pick and choose. ;-)

While thinking about 2006 the first thoughts were that it was the Year of Giving Until It Hurts. I know I've expressed this idea in other posts throughout the year, but I don't have time to go back and link them at the moment. I let myself feel the emotions of self sacrifice (and even some resentment) while recalling all the times I gave until it hurt. Then I was so overcome, to the point of tears, with the realization that I am so extremely Blessed in this life that the whole meaning of The Year of Giving Until It Hurts was transformed into something else, something Divine*. It wasn't only my giving. I've received so much that I have no right or privilege to complain about anything when it comes to my family life. And I am so very thankful for all of my Blessings. It is pleasantly humbling (like a "good hurt") to realize the magnitude of it.

So while I might feel like a doormat in some respects I also now know that I've got to be a really large, durable, and probably comforting doormat to be able to handle all the trampling of this past year. ;-) Perhaps I'm flirting with a Job kind of moment right now in that it's better to be thankful for all the good things in life instead of focusing on what was lost, taken away, or not given at all.

Oh, yeah, the Lemon Tree. For the ongoing lemon tree saga: critter updates, tree of life, tree of life update, waiting, and signs, etc.

I'm still waiting to squeeze those lemons. ;-) But the tree is blooming again! (sorry for the poor quality photo)



And this time there are at least four times as many flowers (many not visible in that photo). Since there are no bees or other bugs I don't know if there will be fruit from these blooms. If the tree self-pollinates maybe there will be. It apparently doesn't get enough light right now to fully ripen the fruit already on it. Well even so, I think I'll ring in the New Year with a glass of premature lemonade. What better way to celebrate this passing year and all of it's sweet and sour moments? After all, even though I hated the poster my college roommate hung on our wall I guess it convinced me anyway that when life gives you lemons, even half-ripe lemons, make the best of it and make lemonade!

So cheers to all and here's to celebrating and being thankful for 2006! And cheers to all and here's to a sweeter and less sour 2007!

Therefore encourage one another and build up one another, just as you also are doing. But we request of you, brethren, that you appreciate those who diligently labor among you, and have charge over you in the Lord and give you instruction; and that you esteem them very highly in love because of their work. Live in peace with one another. We urge you, brethren, admonish the unruly, encourage the fainthearted, help the weak, be patient with everyone. See that no one repays another with evil for evil, but always seek after that which is good for one another and for all people. Rejoice always; pray without ceasing; in everything give thanks...

1 Thessalonians 5: 11-18
New American Standard version

And that is this year's final Sunday Sermonette. Happy New Year!


Retrospection, 2005


---------------------------
* I'm truly sorry for those who cannot experience the Divine in that way. I think that part of the reason why some people refuse to acknowledge the Divine is because it is a kind of painful experience. It does hurt a little at first (just like some other things), but the feeling changes to a kind of rapture (just like some other things). Some people fear that initial pain so much that they won't even approach it. Well, as they say, what you don't know can't hurt you. But they also say, you never know until you try. Let me tell you, the more humble you are the less it hurts to be put in your place.

Christmas Pics

Prettiest girl in the world.


Cutest boys in the world.


Cute green bean bundles my dad made for Christmas Eve dinner.

Because I need a good laugh...

Most recent search terms that brought people here:

jose can you see magazine article title
corvette frame
movie quote: when i was younger, i used 2 think about it a lot and envision how it may have happened....
hoe much does a kitten cost
gay mechanics
bratx dolls
zz top i like your peaches
blanket fetish
what were you doing at midnight survey
hoe movie
slept with my boss married
shasta porn
shine on me dressbarn perfume
sexy hoe
funeral procession etiquette
rae ann london
rae ann spread
i'm a hoe mix
ba humbug sounds
birthday verses
rae-ann
folgers plant
ba humbug
bible verses for birthday
retro spanking
whisker biscuit
she's a hoe
symbolism of lemons
interesting quiz
linda carter breast implants
proper way to address the pope
american hookers hoe
persecution of christians in america
livejournal hoe of the day
corvette road trip
hoe tattoos
crack hoes gone wild
very tiny dicks
birthday proverbs from bible
cobweb weaver
smell a skunk


What kind of place does google think this is anyway? ;-)

Dear Mom,

Happy Birthday. You would have turned 64 today if you were still counting years. It's hard to believe that it's been ten years since your last real birthday. But then so much has happened that it sometimes seems longer than that. How I wish you could see your only granddaughter. She's like some kind of angel, the most beautiful girl you can imagine. I know that you had the biggest hand in that. She is everything I ever wished I could be. Thank you.

And I know you have a hand in the freaky shit that happens, like right now this song just came on the radio:

"One Sweet Day" by Mariah Carey & Boyz II Men

Sorry I never told you
All I wanted to say
And now it's too late to hold you
'Cause you've flown away
So far away

Never had I imagined
Living without your smile
Feeling and knowing you hear me
It keeps me alive
Alive

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Darling, I never showed you
Assumed you'd always be there
I took your presence for granted
But I always cared
And I miss the love we shared

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Although the sun will never shine the same
I'll always look to a brighter day
Lord I know when I lay me down to sleep
You will always listen as I pray

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Sorry I never told you
All I wanted to say

Thanks for that too.

But back to your grandchildren. The six year old, he is an adorable Wild Boy, but in the best ways. And he's so imaginative. He'll probably be a writer or a horror movie-maker. He loves going to kindergarten and is disappointed when the weekend comes.

You wouldn't believe how much the baby you knew briefly has grown up. He's almost 11 but thinks he's 30. To be fair, he's probably smarter than many 30 year olds, but emotionally he's more like 14 or 15. Some kids really do mature sooner these days. He's got (early) Beatles hair which is the current, popular style for boys, and it looks cute on him and you'd like it, I think. Within a year he'll be taller than me.

Rhonda is still the pretty one, and our difference in that regard seems to increase each year. I don't think I'm the smart one anymore. I'm not sure what I am. And sometimes I'm glad that you don't have to see how life has left its marks on me over these ten years. In some ways it is scar tissue that holds me together, so I must be thankful that it is there, whatever form it takes. You always said, "Beggars can't be choosers."

I miss you so much. I hope that Heaven is everything you hoped for, and more.

Love,
Rae Ann

Finished!

My Christmas shopping is done! If it ain't done been got, it ain't gonna get got. ;-) Not by me anyway.

Now comes the wrapping marathon. Thank God for gift bags! LOL

Merry Christmas, Happy Holidays, and Blessings to all!

Tagged!

Lubos has tagged me. Here are the rules:

Grab the book closest to you.
Open to page 123, go down to the fifth sentence.
Post the text of the next 3 sentences on your blog.
Name the book and the author.
Tag three people.

Here it is:

"We traversed the ideological line into the theater of physical causes governed by natural law where you and I are subject only to the mindless action of matter instead of being engaged in a conscious dialogue with it. The Earth-centered universe is inward-directed, which we usually characterize as closed and negative, while the heliocentric universe is outward-directed, open, and, therefore, positive. Having lived under its domain for so long, we cannot imagine what it must have been like to exist in a cosmos like Dante's - in a world that permits the human voice to penetrate to all levels of existence."

from Behind the Crystal Ball: Magic, Science, and the Occult From Antiquity Through the New Age by Anthony Aveni

I haven't read this entire book, but it does have a chapter about Richard Feynman.

I'll tag CIP, Guy the Savage Farmer, and DHammett (because he'll do it even without his own blog).

Come on, guys, you've got to play along. Even Lubos did this one!

New and Improved!

Vicious Momma and "I'm a Hoe", as well as "Lyrics of the Moment", have now been upgraded to the new Blogger which is no longer "beta." The switch was painless, though I still need to go through and label posts in various categories. Fortunately, this is something that can be done later when the holiday rush has passed.

Good News for String Theory

While looking through my kindergartener's school work last night I was pleased to find this:



Now, I'm not sure how long the concept of symmetry has been taught in kindergarten, but I do know that my 10 year old did not bring home any work like this when he was in kindergarten six years ago.

About a week ago I also saw several papers in my second grader's work that covered the concept of symmetry. I would interpret this trend as good news about the "trickle down" effect of String Theory's acceptance in a more general educational sense. Of course, String Theory did not invent Symmetry, but it has made symmetry an important foundational idea.

One Week 'Til Christmas

I borrowed this from eatmisery.

1. Eggnog or Hot chocolate?
hot chocolate

2. Does Santa wrap presents or just sit them under the tree?
some of both

3. Colored lights on tree/house or white?
both, I'm a Redneck! ;-)

4. Do you hang mistletoe?
sometimes, if someone will shoot it out of a tree. there is a lot growing in the oaks

5. When do you decorate for Christmas?
after Thanksgiving

6. What is your favorite holiday dish? (Excluding desserts!)
my sweet potato souffle that's not really a souffle

7. Favorite holiday memory as a child.
waking up ungodly early to see if Santa had come yet

8. When and how did you learn the truth about Santa?
probably around age 8 when it was thunderstorming real bad on Christmas Eve night and I knew that Sants couldn't navigate an open sled in that weather.

9. Do you open a gift on Christmas Eve?
usually

10. Do you bake cookies every year?
not recently, but this year Santa will get blackberry muffins instead of cookies because he's got to be sick of cookies by now

11. Snow? Love it or dread it?
love it but I've never had a real, true white Christmas

12. Can you ice skate?
used to

13. Do you remember your favorite gift?
age 7 I got a doll called The Littlest Angel. I just loved that doll!

14. What's your favorite thing about the holidays? What's the most
important thing about the Holidays for you?
getting to treat people with things they don't normally get; friends and family

15. Favorite holiday dessert?
pecan pie

16. What is your favorite Holiday tradition?
giving gifts

17. What is your tree topper like?
honestly, I'm not sure because the kids decorated the tree and I didn't notice the top

18. Do you like to give or receive?
Both.

19. What is your favorite Christmas carol?
"Blue Christmas" by Elvis and "Winter Wonderland" (most versions)

20. Candy canes? Yuck or Yum?
yuck, usually

21. What was the one gift you always wanted for Christmas but never got?
as a child, a Lava Lamp, but I do have one now! LOL

22. Do you buy a gift for yourself when shopping?
just something small

23. Favorite Christmas Movie?
Not sure, probably Miracle on 34th Street

24. How do you decorate your Christmas Tree?
I make the kids do it. We have lots of variety in ornaments. I like that better than a perfectly coordinated department store tree.

25. What do you do on Christmas morning?
open presents then go to grandparents' house to open more presents and eat

Quick Question

Recently there have been lots of visitors from Belgium using the search words "hoe jumpen". Is this some kind of foreign porn? LOL

Chimerical Mail Time

Hello Rae Ann,

I'm writing to express concern for your apparent instability lately. Are you okay? Are you doing everything in your power to improve the situation? Thanks.

Concerned

Dear Concerned,

Thanks for being concerned. It really helps more than you realize to know that someone actually is concerned. :-) Yes, I believe I'm on the road to recovery from a little wild roller coaster of a time. Though, it would be unrealistic to expect that things won't ever get a little crazy. That's just the way things are around here. Again, thanks for caring.

Rae Ann


Dear Rae Ann,

Inquiring minds want to know. What is your connection to Lubos Motl?

The National Enquirer

Dear National Enquirer,

Don't you usually offer people lots of money for juicy, exclusive stories? Well, sorry to disappoint you (and myself), but I can't answer that question. And the reason I can't answer it is not because my spokesperson hasn't collaborated with his spokesperson, but because that answer has not yet been defined. Sorry, inquiring minds will have to keep wanting to know. Thanks.

Rae Ann


Hi Rae Ann,

Why don't you ever post pictures of yourself? Is it because you're fat and ugly?

Anonymous

Dear Anonymous,

Well, I'm not in the habit of taking (and sharing) pictures of myself for many reasons. I'm usually the one taking the pictures of everyone else. And I've grown past that stage of needing to see myself in pictures and needing others to approve of my appearance in those pictures. And yes, I do think I'm fat and ugly, at least compared to when I was young. But I've earned the right to have a spare tire and some gray hair and wrinkles and all those other 'landmarks' of life. I've lived a lot in the last 15 years and it shows. But you know what? In the long run I think that my fat genes will prove quite beneficial and adaptive for my offspring. My kids are not fat at all, however, but they probably do carry the genes for fat storage. I think all of those super skinny people and their offspring, if they manage to have any, will die off much quicker when the New Ice Age hits. Diversity is the spice of life. Besides, it's much more sensuous to cuddy up to someone soft and warm than cold and skeletal. But I suspect you'll never have that pleasure.

Rae Ann


Dear Vicious Momma,

What is up with you and religion? Are you in or are you out?

Confused

Dear Confused,

Only God knows the secrets of my heart. ;-)

Rae Ann aka Vicious Momma

ABCs

• A-Available/Single? not single

• B-Best Friend? Ellen

• C-Cake or Pie? depends

• D-Drink Of Choice? White Russian if you mean alcohol.

• E-Essential Item You Use Everyday? toothbrush

• F-Favorite Color? I'm into yellow right now.

• G-Gummy Bears Or Worms? I hate that gummy crap.

• H-Hometown? Knoxville, TN

• I-Indulgence? long, hot baths

• J-January Or February? January.

• K-Kids & Their Names? three, but their names aren't public

• L-Life Is Incomplete Without? love

• M-Marriage Date? 5-25-1991

• N-Number Of Siblings? one sister

•O-Oranges Or Apples? apples, but orange juice

•P-Phobias/Fears? losing a loved one

• Q-Favorite Quote? When the gods want to punish you they answer your prayers. (from the movie Out of Africa)

• R-Reason to Smile? my kids

• S-Season? spring

• T-Tag Three People? not tagging anyone, but feel free

• U-Unknown Fact About Me? I can spread my toes like a monkey.

• V-Vegetable you don't like? turnip

• W-Worst Habit? I pick at my cuticles.

• X-X-rays You've Had? too many to list

• Y-Your Favorite Food? chocolate

• Z-Zodiac Sign? Aquarius

Bunch of Questions

When you looked at yourself in the mirror today, what was the first thing you thought? Yuck.

How much cash do you have on you? in my purse, about $200, but I don't usually have that much. it's Christmas money

What's a word that rhymes with DOOR? Whore

Favorite planet? other than Earth, probably Jupiter

Who is the 4th person on your missed call list on your cell phone? I don't think it goes back that far. I never get calls on it.

What is your favorite ring tone on your phone? my phone is an antique and doesn't have different ring tones

What shirt are you wearing? old Body Glove t-shirt

Do you label yourself? sometimes

Name the brand of the shoes you're currently wearing? MIA

Bright or Dark Room? depends on what I'm doing

What do you think about the person who took this survey before you? she's pretty cool!

What does your watch look like? I don't wear a watch

What were you doing at midnight last night? sleeping

What did your last text message you received on your cell say? I don't get text messages. Nobody cares about me. :-(

Where is your nearest 7-11? we don't have them here

What's a word that you say a lot? really

Who told you he/she loved you last? my daughter

Last furry thing you touched? My dog.

How many drugs have you done in the last three days? hehehe, I take my prescription every day.

How many rolls of film do you need developed? one or two probably

Favorite age you have been so far? honestly, probably 18-21. Too young to know and too stupid to care.

Your worst enemy? myself

What is your current desktop picture? the Corvette

What was the last thing you said to someone? Be careful.

If you had to choose between a million bucks or to be able to fly what would it be? fly

Do you like someone? "like" as in "like"? Or "like" as in "would like to get to know better"? Well, yes, on both counts.

The last song you listened to? some 80's power ballad on the radio after dropping of the kids

What time of day were you born? 4:57 am

What's your favorite number? 25

Where did you live in 1987? partly at Maryville College, partly at Marietta, GA

Are you jealous of anyone? not jealous, really

Is anyone jealous of you? don't know

Where were you when 9/11 happened? in my living room watching it happen on TV

What do you do when vending machines steal your money? sometimes kick it if no one is around

Do you consider yourself kind? usually

If you had to get a tattoo, where would it be? I don't know. that's why I've never gotten one.

If you could be fluent in any other language, what would it be? physics ;-)

Would you move for the person you loved? well, been there, done that.

Are you touchy feely? depends

What's your life motto? If you can't laugh about it you're screwed.

Name three things that you have on you at all times? I don't have things on me at all times.

What's your favourite town/city? I don't know.

What was the last thing you paid for with cash? Some Christmas gifts at Target yesterday.

When was the last time you wrote a letter to someone on paper and mailed it? several years

Can you change the oil on a car? Probably, but that's a man's job.

Your first love: what is the last thing you heard about him or her? wow, I haven't heard anything

How far back do you know about your ancestry? Most sides of the family have someone who does geneology so they've gone back to the 1600s in America.

The last time you dressed fancy, what did you wear and why did you dress fancy? I can't remember the last time I dressed fancy.

Does anything hurt on your body right now? fortunately, no

Have you been burned by love? Who hasn't?

TMI Tuesday Sermonette

warning: for those who are very sensitive, please know that this post contains potentially blasphemous and shocking statements

Yes, this is Wednesday, but I started this last night so the title stands.

The other night I was thinking about why this time of year is so difficult and this thought occurred to me. God-centered religion has really harmed women a lot over the ages and it becomes most apparent at this time of year.

Christmas is the celebration of Christ's birth. We celebrate the arrival of the baby. But somehow it is ignored that birth also involves a woman. Well, you can't give birth to anyone without a mother. The Protestants, especially Fundamentalists, completely ignore that messiness of birth in their celebrations. Well, I've got news for them:

Jesus came out of Mary's VAGINA!

(I was wallowing in my misery, and by God, I think I found a little bit of my missing humor. Sometimes you have to get real cozy and familiar with your misery so you'll learn something from it. Hell, just dive into it and swim. You might find some of those things that sank to the bottom and were lost. Sometimes I dream that I can breathe under water. It's weird, but cool.)

Okay, so Christmas is as much a mother's holiday as anything else, whether you like to admit it or not. And we all know that in most families it is the mother who assures that Christmas happens at all. We do most of the shopping, decorating, and all that. It's a lot of work that goes mostly unnoticed and unappreciated, unless there is some disaster and someone doesn't get what they asked for. Well, then, it's all Mom's fault for not finding it, and never mind all the other crap she did get you. This is what happens when you take the mother out of birth and just celebrate the child. The children get spoiled! And the mothers become downtrodden.

People say, "Jesus is the Reason for the Season." Well, sure, but he wouldn't have gotten here without his mother. Someone should invent a new slogan for the holiday that celebrates Motherhood and the pains that mothers go through to bring their children into the world and also the pains that mothers go through to make their children happy. Sorry, I'm not feeling especially inventive right now. If it were up to me the new slogan would be "Jesus came from Mary's vagina." But I really don't think that will catch on too well.

Now, before any self-righteous nincompoop gets their panties or boxers or briefs or whatever in a wad, just consider this: Ten years ago my mother was dying - wasting away with cancer during that holiday season. The tenth anniversary of her death is just a few days after Christmas. So allow me a little expression of mourning and if that expression takes the form of blasphemy I think God will forgive me whether anyone else will or not. And that's the point of Jesus coming out of Mary's vagina in the first place, right?

So I miss my mother and it's very sad to me that two of my children never met her and will only know her from pictures and stories. It really kind of SUCKS. And the holiday season which is as much a reminder of motherhood as you can invent is pretty painful for me. I don't expect anyone else to really understand because you can't until you've lost your own mother, but maybe if anyone actually reads this they'll see the holiday with a new perspective and appreciation for the women who keep the holidays coming every year.

And you know what, we all came out of our mothers' vaginas. Well, except for those who were born via c-section, like my children. But still they came out of my body. Maybe that new slogan could be something like "Jesus came from Mary's belly." Yeah, that's not so bad.

And that is this week's sermonette. Hey, many churches have Wednesday night services, so there you go.

Ba Humbug

I'm sorry to report that I have no Christmas spirit this year. It has apparently been sucked into the same black hole that has absorbed my sense of humor and equilibrium. I hope that the universe on the other side is enjoying its newly acquired assets. Perhaps that is all it needed to invent life for itself. Well, I hope it enjoys it while it lasts, which probably won't be too long. Just ask the gorillas. ;-)

Everyone have a wonderful Christmas. I won't be around much, if at all. Sorry.

Hard Hearted?

Gorillas are dying and could end up extinct soon if ebola and hunting continue. Well, the hunting is one thing, but the ebola is quite another. Now, I don't mean to sound very hard hearted, but shouldn't we let Nature take its course if there is a disease that is eliminating an evolutionary dead end? How many species of primates have gone extinct so far? Is it really in the best interest of the planet to try to "save" every species that has probably lived out its course of life here? Perhaps it's in the best interest of the planet to let the gorillas die off and maybe the ebola virus with them? It is believed that humans contract ebola from the gorillas. Well, don't we kill off cows that have mad cow disease to keep it from spreading? And don't we kill off birds that carry the bird flu? Are we not supposed to protect our own population from real threats such as ebola, or is it more important to cut our CO2 emmissions? If you ask me I think ebola is much more threatening to human life (and that of other animals) than some mythical global warming. Sure, sometimes we like gorillas more than cows and birds because we think they are more like us. But how much like us are they really? I don't know the genetic information on that and I'm not looking it up right now.

Well, this isn't a Sunday Sermonette, not yet anyway. I might modify it later. ;-)

Friday Five

1. Are you complicated?

Probably not as much as I think I am. ;-)

2. Do you retaliate?

I fantasize about it.

3. Last person to hug you?

My oldest son. He had a rough day.

4. Your latest complaint:

I'm tired of being human.

5. Who was the bully on your playground?

Some people might answer that with my name. ;-)

Random Transcendentalism

Cell Division
Magnetism

The religion that is afraid of science dishonors God and commits suicide . . .

Standing on the bare ground, my head bathed by the blithe air, and uplifted into infinite space, all mean egotism vanishes. I become a transparent eyeball. I am nothing; I see all; the currents of the Universal Being circulate through me. I am part or particle of God . . .

There is no screen or ceiling between our heads and the infinite heavens . . . no bar or wall in the soul where we, the effect, cease, and God, the cause, begins.

Ralph Waldo Emerson, various essays

I believe in the flesh and the appetites; Seeing, hearing, feeling, are miracles, and each part and tag of me is a miracle.
Divine am I inside and out, and I make holy whatever I touch and am touch’d from;

Walt Whitman, "Leaves of Grass"

Circular Crops

I'm Ready

(this picture doesn't have anything to do with anything; I just wanted to put a picture in this post)


Take me to the Stepfordizer. I've decided that I just really don't like being human. There are just too many discomforts and other hassles. Come to think about it, I've never really liked being human. I must have done something terrible in my past lives. ;-) Can I be a robot instead of a human now?

Fortune Cookie

make your own fortune cookie

DNA Message

AGAATGTAGGGCTAAGCGCTGATGGTACTTCGTGCGGCGT
CAATGGCGGATGCCCTTATGGTTGGCATGGTCCGTTCAATGGTCG
GCGCTCTTGTTGAGGATGGAGACATGTACCTTGTATCAATGCTG
GATGTAGTTTCAATGCTATAAGTTATGAGAGCGGCGATGCT
TTATCTTGTACTCGATGTCCTTATGGTCGGCGCTCTTATGGTCCTTG
CGGAAATGCTCGGCGGAGTTGTAGGCGCGATGGTTGAG
GATGTCATGGTTGATGCTCTTGTG

(I had to break it up into several lines so it would fit on the page. To decode it you'll have to return it to a whole, long string.)


Create and decode a message in DNA.

What People Are Looking For

It's interesting to note the search terms that bring people here. Currently, the most popular searches are for "birthday verses" which lands people here.

TMI Tuesday

Because I'm lacking the time and imagination to come up with my own ideas this week, I'm borrowing an idea from here, a blog devoted to TMI Tuesday memes.


1. My biggest sexual turn on is __________?

kissing

2. On a scale of 1-10, how jealous do you get (have you gotten)?

been to 10 a few times

3. Have you ever had sex with someone you work(ed) with? Any negative consequences?

yes, no

4. Wash up, cuddle or fall asleep?

depends on many factors

5. Which is more important of the two in "chemistry," physical attractiveness or sexual performance?

performance

6. Do you regret any past sexual partner, sexual liaison, or missed opportunity for one?

yes, yes, and yes

7. Have you had sex with a virgin after you lost your virginity?

yes, but he was older than me (at least he told me he was a virgin)

8. What is your favorite sexual position? If different, which one do you enjoy the most?

well, that is definitely too much information

Bonus (as in optional): What kind of birth control do you use?

sterilization, 100% effective

Close Enough for Rock 'n' Roll

Jesus quote generator

Please don't crucify me!

Alive and Kicking

This has been a very busy week with two days occupied by the book fair at school. I volunteered to work at it a lot because it's one of the more fun fundraisers that the PTO has throughout the year. Aside from that I've been trying to get the house back in order after the Thanksgiving dinner, etc. And yesterday my Internets were totally tangled, knotted up, and inaccessible. Man, that is so hard to deal with! But today it seems to be all straightened out so here I am. Still alive and kicking.

Being away from the house a lot during the day can really put my (very loose) routine into a mess. So much to do and much less time to do it. So I better be off to get some work done!

Jump-Start My Brain

Some questions found here to jump-start my brain this week:


Could you ever be in love with someone you knew you couldn't trust?

Sure, trust is more fragile than love.

Would you rather have a strikingly attractive spouse who was disappointing in bed or a plain-looking spouse who was fantastic?

Definitely the plain-looking but fantastic lover.

Is it easier for men or women to find good partners?

I think men have it easier than women. Not that it's necessary easy, just easier.

If you could spend one night with anyone in the world you desired, but only by getting permission from your partner, would you ask for it?

Sure, you never know unless you ask.

If you found your true love, how long would you wait for him/her to return your love?

I'm kind of impatient and demanding. I'd be thinking, "If it's true love then he should know it too and be ready to return it." Unrequited love isn't "true love."

Ridin' With PB 16

Food for Thought

TURKEY, n. A large bird whose flesh when eaten on certain religious anniversaries has the peculiar property of attesting piety and gratitude. Incidentally, it is pretty good eating.

EDIBLE, adj. Good to eat, and wholesome to digest, as a worm to a toad, a toad to a snake, a snake to a pig, a pig to a man, and a man to a worm.

Ambrose Bierce

I've been in the kitchen all day doing as much prep work as possible to make tomorrow's marathon of cooking go as smoothly as possible. Some of the things already done:

cranberry sauce (made from fresh berries, not that canned crap),
baked and peeled sweet potatoes (for casserole),
chopped three cups of onion and celery (combined, not 3 cups each) for cornbread dressing,
baked cornbread for dressing (from scratch, not a mix),
shelled pecans for sweet potato topping,
mixed the rest of that 'praline' topping,
daughter crumbed up the cornbread (she loves to do that).

I'm sure I'm forgetting something. Anyway, I still should mash the sweet potatoes and mix up the casserole and maybe cook the turkey giblets for the dressing and gravy tomorrow. It is a lot of work to do all of this from "scratch" but it is a nice way of expressing thankfulness and true appreciation for all the good things in life. It is truly gratifying to put forth that much energy towards nourishing those I love. However, it's not only nourishing, but an uncommonly rich preparation of food. Rich in flavors, as well as energy (high calorie, for sure). Feeding someone is at the most basic level, giving life. This is why Jesus used bread and wine as metaphors for the Life he was offering to his disciples. There I go again with that religious kick. ;-) (maybe these "kicks" are actually like "tics" or something? lol)

To be honest though, if I had to do this all the time I wouldn't have time for anything else. And I like doing other things. But then, this is why we have a Thanksgiving Day set aside to lavish our loved ones in special ways.

Happy Thanksgiving!

A Rant

I'm kind of on a relgious kick these days. Sometimes that happens. Maybe it's part of being a little crazy. Maybe it's lots of other things too. There have been a few distinct periods in my life when I've focused my mental energy on the Divine and how it fits into my world. I've always known that there is Something Larger Than Me. And I've always, in the back of my mind or maybe in my left heart ventricle, known that my life has a purpose, even if it's only to perpetuate my species and try to improve my immediate surroundings while here. I see no conflict with God there.

I'm also on a science kick, but that's been a much more consistent, enduring kick in my life than religion. I see no conflict with God and science. But that is a minority view, it seems. Some fancy-schmancy writer wrote an article called My God Problem. I suppose she thinks she's clever to insult people for believing in things they cannot prove. Her condescending attitude is exactly the kind that turns most normal, God-fearing people's stomachs. She has no respect for humanity. People think, "Gee, if not believing in God makes you a catty bitch who thinks she's better, smarter, and more important than everyone else, well, no thank you very much. I'll stick with God if Science creates jerks." This is a problem that any scientist with a heart needs to consider.

People resist evolution because they think it dehumanizes them, just like Ms. Smartypanties' article dehumanizes them by calling them "poor gullible gits" among other things. Of course, I know that evolution and science don't dehumanize me, but I'm speaking for other people here. They've had their school prayers taken away by irrationally angry atheists, and now here's this high-falutin author trying to rile up the scientists to bring on an all-out war against God and religion.

I recognize that science doesn't have all the answers and doesn't pretend to, and that's one of the things I love about it. But it has a pretty good notion of what's probable or possible, and virgin births and carpenter rebirths just aren't on the list. Is there a divine intelligence, separate from the universe but somehow in charge of the universe, either in its inception or in twiddling its parameters? No evidence. Is the universe itself God? Is the universe aware of itself? We're here. We're aware. Does that make us God? Will my daughter have to attend a Quaker Friends school now?

I don't believe in life after death, but I'd like to believe in life before death. I'd like to think that one of these days we'll leave superstition and delusional thinking and Jerry Falwell behind. Scientists would like that, too. But for now, they like their grants even more.

I think Ms. Smartypanties is a little confused about science and its place in the world. She says that science doesn't pretend to have all the answers. Some of it thinks it does, and makes a big to-do about it. And she's upset with the scientists for being more concerned for their financial well-being than for converting all Americans to atheism. Look, lady, get your head out of your ass. Scientists are people too, and most of them just want to get through their days, weeks, months, and years and pay their bills and live their lives. Most people aren't interested in running crusades one way or the other. How has religion hurt you? It's probably only added to your bank accounts.

Yes, yes, I know all the arguments about the evil deeds done in the name of God or Allah or whatever diety. Sure, there is a lot of that. But no one really stops to think and list out all of the good that is done through religion or inspired by the Divine. How many schools, hospitals, ophanages, etc. have been built and maintained by religious efforts? How many lives have been saved by people moved by a force that they can only identify as God? The list is endless. I don't recall that part of the scientific method includes leaving out evidence just because you don't like where it comes from and only including the evidence that supports your hypothesis (in this case, that religion/God is worse than it is good). Where's the scientific objectivity when looking at God and religion? You won't find any in Angier's article.

On a kind of personal note, I didn't see any mention of children in her bio. Now, I know this is a very controversial thing that I'm about to say, but I'm willing to bet that it's closer to true than not. Many childless women lack a certain capacity to love and respect life. And indeed, having children was a pivotal event in my own spiritual evolution because of the absolutely overwhelming love that filled me. Perhaps it was/is only biological responses and so on. Fine if it is. But it is surely more powerful than anything that science has discovered or created, so what's wrong with attributing it to some Divine Force?

Well, I don't want anyone to misunderstand the point of my little rant here. I'm not dissing science and scientists. I love science and scientists! Some much more than others. :-) But I also have a close relationship with something that I believe is Divine. If that makes me a "poor gullible git" then I'll just be a poor gullible git instead of a well-paid but heartless bitch.


(Ms. Angier could be a very nice person. I don't know; I'm only responding to the attitude reflected in her article.)

Birthday Verses

I got this idea from a catalog item that personalizes a bible verse with your birthday. Like mine is 1-25, so I guess they pick out a nice verse that matches. So I decided to see what I could find. Here are my favorites:

1 Corinthians 1:25

"Because the foolishness of God is wiser than men; and the weakness of God is stronger than men." KJV

Genesis 1:25

"God made the animals of the earth after their kind, and the livestock after their kind, and everything that creeps on the ground after its kind. God saw that it was good." KJV

Deuteronomy 1:25

"They took of the fruit of the land in their hands, and brought it down to us, and brought us word again, and said, "It is a good land which Yahweh our God gives to us." KJV

Proverbs 1:25

"but you have ignored all my counsel, and wanted none of my reproof;" WEB

Isaiah 1:25

"And I will turn my hand upon thee, and purely purge away thy dross, and take away all thy tin" KJV

Ezekiel 1:25

"And there was a voice from the firmament that was over their heads, when they stood, and had let down their wings." KJV

Luke 1:25

"Thus hath the Lord dealt with me in the days wherein he looked on me, to take away my reproach among men." KJV

Romans 1:25

"For they had bartered the reality of God for what is unreal, and had offered divine honours and religious service to created things, rather than to the Creator -- He who is for ever blessed. Amen." WEY

(Probably the best bible verse website I've found is Bible Browser. It's very quick and easy to use.)

Since I didn't do a Sunday Sermonette yesterday, maybe I'll do just a bit of Monday morning sermonizing.

The Mind and Heart of God

"Because the foolishness of God is wiser than men." I like that, and I think it's very true, especially in light of my recent rather perilous journeys into the Mind of God. It is very easy to become overwhelmed and disoriented in the vast, infinite really, expanse of possibilities within God's Mind. In order to keep from becoming completely lost one must have very special tools, a very good internal compass, and/or a guide.

"For they had bartered the reality of God for what is unreal, and had offered divine honours and religious service to created things, rather than to the Creator." Man must be careful not to rely too much on the creations of his own mind, for the human mind is susceptible to error and misjudgment. In the Mind of God we can see many things that are possible but not necessarily real and realized. In God all things are possible, and by extension since we are created in God's image we can create many things in our own minds. But just because it's possible to create them in our minds does not mean that they are real or realizable. When faced with all of these possibilities one must rely upon his special tools, internal compass, and/or guide to know the truth.

So what are these special tools? They are the Laws of Nature which keep those who know them on a path of reality. And what is this internal compass? I think it is our heart knowledge. This comes from God and not from our own minds. Incidentally, yesterday I did hear a little bit of a sermon on TV about how God often speaks to us through our hearts instead of our minds. This is the source and expression of faith. Faith lives in our hearts and comes straight from the Heart of God. We must learn to listen to our hearts and have faith in that heart knowledge because it comes from God. "And I will turn my hand upon thee, and purely purge away thy dross, and take away all thy tin." What that means is that when we have faith in the Heart of God he will purge away the "dross and tin" (falsehoods and impurities) that our own minds have created. And if we think our hearts are foolish, we should remember that "the foolishness of God is wiser than men."

Most people cannot rely only upon their tools and compass. They need a guide to the Mind and Heart of God. Jesus is the guide for many people. There is more to say about this than I am able, "but you have ignored all my counsel, and wanted none of my reproof."

Well, I guess what I'm trying to say is that we humans aren't infallible. We make mistakes because we listen to our minds instead of our hearts. But in the infinite Mind and Heart of God we can find our way to the Truth when we have our tools, compass, and a guide - whether it is Jesus or another gift from God.

And that's this week's sermonette.

Pretty Accurate

You Are A Cypress Tree

You are strong, adaptable, and striving to be content. You're good at taking what life has to give - even if you don't like it. A passionate lover who can't be satisfied, you are quick tempered at times. You hate loneliness, want love and affection, and need to be needed. A bit of a live wire, you love to gain knowledge any cost... and you can be careless at times.

What's Your Celtic Horoscope?

Except for the clothes part this one is good too:

What Your Bathroom Habits Say About You

You are a giving soul. Way too giving in fact. You often get stuck doing the dirty work that no one else will do. You spend a lot on clothes, and you tend to be a very dresser. However, it's hard for you to throw away trendy clothes when they go out of style. You have the perfect blend of confidence and class. You're proud of who you are - but you don't broadcast it. In relationships, you tend to be very romantic and demanding. You'll treat your partner like gold, but you expect a lot in return.

What Do Your Bathroom Habits Say About You?

(glad Kat is still posting)

Reality Check

Wow, I've been in some kind of weird alternate universe or dimension or something - maybe causing, or caused by, an attack of brain arrhythmia. One of my brothers-in-law has cardiac arrhythmia and has a pacemaker, but occasionally his heart gets out of rhythm even with the pacemaker so he has to go get "shocked" back into rhythm. Maybe I need some electro-shock therapy on my brain? ;-)

I have to joke about this because that's the only way I know to deal with it. It's so frustrating to have to ask people kind of dumb, far-out questions in order to get get back to reality. It's kind of like asking someone, "Do I have boogers hanging out of my nose?" Kind of awkward and embarrassing. My poor husband has had to tolerate my outrageous questions for many years and learn not to take them too personally, and it seems sometimes that it's more trouble than it's worth for him. Sometimes I wonder if he's disappointed that he's ended up with a crazy wife.

Part of the problem is that probably 80-90% of my intutions are correct or mostly correct, so it can be hard to tell when a thought falls into the 10-20% of totally wrong without some extrinsic validation or invalidation. Therefore "reality checks" are vital to functioning well. So, if I or someone else asks you what sounds like a totally crazy and outrageous question, be kind and give a straight, honest answer. It will be very much appreciated, and it might even make a huge but unseen difference in mental health. ;-) And thank you to all who have been kind to my own strange questions.

Proud Momma

I don't talk about my kids much here. It's mostly a matter of privacy and protecting them. Since this is a somewhat adult themed place, Google often sends people here looking for some pretty nasty stuff. You can't be too careful when it comes to protecting your kids' identities, etc. on the tangled up tubes of the Internet where creeps can be lurking anywhere. But all of that said, I do want to talk a little about my wonderful progeny.



This drawing was done yesterday by my six year old son. I really love it because it seems very complex - emotionally and symbolically- coming from a six year old. He loves to draw and make books that tell fantastical stories about blood, guts, death, and so on. I asked his kindergarten teacher if I should be concerned with his fascination with death and stuff, and she said that it's pretty common for his age. I recall my oldest son also drawing gory pictures when he was younger, but he was probably not as prolific with it.

My youngest is kind of a typical youngest child. He's very imaginative, outgoing, adventurous, and perceptive. I've been a little off my rocker the last couple of weeks, and I wonder if my instability is somehow reflected in his drawing. We are especially close in an unspoken kind of way. At some point I want to tell the story of his 'becoming' because it is kind of unusual. Bringing him into the world was very physically traumatic but emotionally healing.

Whatever my phenotypical (visible traits produced by the interaction of genotype and environment- for those whose last biology class is a distant memory, like mine) deficiencies might be, in my children I can see that the genotype (genetic constitution) isn't so bad. Actually, I'm quite amazed that they came from me at all! I only hope that they were spared any of my bad genes.

Oops!

Wrong blog.

Slow Ride

Another One Bites the Dust?

Wow, bloggers are dropping off left and right. I was just cruising through my blog-reading folder and found several closed or gone alltogether. This morning I read that Kat is probably leaving the blogosphere. What a bummer! But I have to confess that this week I've been seriously considering a break myself. I even made up a cute picture:

(tombstone generator)


But, I'm such a persistent little piece of shit, and once I've infested a place I'm hard to get rid of. So I guess I ain't goin' nowhere. Not yet anyway. Well, unless they finally come to haul me off to the looney house or string me up and crucify me. This is really just like talking to myself anyway (yes, I'm certifiably crazy and crazy people really do talk to themselves), and occasionally other people might pass within hearing range. I love feedback, by the way, and I'd love to read more comments from people even if they aren't exactly on topic. I'm not a topic Nazi.

While I'm talking crazy let me say something about the Eye of Saturn, which is a hurricane-like storm recently discovered on Saturn, the planet of discipline and responsibility in astrological terms. This storm has probably been there for a very long time, but the timing of its discovery (Oct. 11, 2006) seems kind of interesting, if only in my own screwed up head.

No Brainer (or kitten work)

I've done another tarot card this week. It's one that I kind of think of as a "no brainer" because it's meaning is pretty well 'set' and so there's not a lot of variation in the imagery that works. This is part of the tarot system. It's very iconic and representational. Of course, these qualities aren't highly valued in the art world of today. All the hip art is vague and abstract and non-representational in nature. The artists claim that they don't want to impose their vision on anyone else, and so on and blah, blah, blah. Fine. Freedom is cool. But so is some guidance.

I like to think of tarot cards and early tarot readers as the counselors of their day. Oh, I'm not going into the history of tarot other than that it's pretty old, probably from around the fifteenth century or thereabouts. I'm being lazy today and not looking things up and linking. If you don't believe me then look it up yourself and then come back and tell me how wrong I am.

The cards in a tarot deck generally represent milestones, problems, stages of development, etc. that we all face throughout life. Imagine that a person in the sixteenth century was having some emotional concerns and needed some guidance. She probably went to the local 'healer' or 'witch' or 'shaman' or whoever for a 'counseling session' with the cards. Back before mass literacy and paperback self-help books people had to rely on other ways. Of course, they could go to their minister or the church for guidance, but sometimes we need something different from that.



The traditional imagery for the 8 of Wands is of 8 wands (sometimes staves, spears, or arrows) speeding through the air en route to whatever destination. We are only seeing the motion and have no idea where they came from or where they are going. We don't know if they are friendly or antagonistic or in what spirit they went flying. We don't know if they'll hit their target or fall very short or long. All we know is that they are going. They represent urgency. They can indicate important messages or other signals. They might indicate sudden travel. Sometimes they can imply the arrows of love, depending on the context in which the card is chosen. In the broader sense the 8 of Wands means that some issue is at its peak of movement. Nothing can stay in the air forever. Sometimes we just have to take some comfort in knowing that something is moving. And we have to accept that we don't have control over their flight or landing. We just have to let gravity do its work.


And actually, this card can pretty well describe the current environment and issues in Washington, DC, as well as some closer to home. Let the arrows fall where they may. I just hope they don't end up in my, or anyone else's, back.

Signs, Omens, and Miracles

Signs, signs, everywhere there's signs
Fuckin' up the scenery, breakin' my mind
Do this, don't do that, can't you read the sign?

Tesla version of "Signs" by the Five Man Electrical Band

A lemon turned into an orange. One of the fruits got damaged when I moved the tree inside due to below freezing temperatures. It turned orange, smells like an orange, and tastes like a very sour orange instead of a lemon.

(sorry for the low quality photo, I'm a little shaky today)

What does that mean? Is it a good sign, a bad omen, a miracle? Have I been fooled all along? I think I've just lost all grip I ever had on reality. Maybe it's withdrawal hallucinations. I think I need a fix, just one more... then, dear God of the Cute Kittens and Knowing My Limits, I'll quit. Just one more...

Physics Anonymous

Hi, I'm Rae Ann, and I'm addicted. And it's a problem.

God grant me the serenity
to accept the things I cannot change;
courage to change the things I can;
and wisdom to know the difference.

It's time for a twelve-step recovery program:

1. Admit I am powerless over my addiction - that my life with it has become unmanageable.

Done. I'm powerless and my life is unmanageable.

2. Believe that a Power greater than myself could restore me to sanity

Done.

3. Decide to turn my will and my life over to the care of God as I understand God

From now on I surrender my life to the God of Cute Kittens.



4. Make a searching and fearless moral inventory of myself

Done. I've spoken of things I know nothing about. I've sinned against science and nature.

5. Admit to God, to myself and to another human being the exact nature of my wrongs

Done. The exact nature of my wrongs is that I've asked silly questions and made stupid comments and wasted the valuable time of serious scientists, possibly interfering with the advancement of their work.

6. Be entirely ready to have God remove all these defects of character

Done. I'm ready. Entirely.

7. Humbly asked God to remove my shortcomings

Done. Please, God, take this compulsion away, make me know my limits, and make me a better kitten lover so that my natural sweetness can shine through.

8. Make a list of all persons I have harmed, and be willing to make amends to them all

Done. Lubos, Bee, Kea, Mahndisa, Louise, Nigel, Matti Pitkanen, Lee Smolin, and yes, even Peter Woit. If I've left anyone out, please tell me.

Too all: I'm offering to make amends for wasting your time, etc. I'm not sure what kind of amends would work, so you'll have to let me know.

9. Make direct amends to such people wherever possible, except when to do so would injure them or others

Until I'm told otherwise, the only amends I know is to only think of cute kittens and keep my mouth shut.

10. Continue to take personal inventory and when wrong promptly admit it

Will do.

11. Seek through prayer and meditation to improve my conscious contact with God as I understand God, praying only for knowledge of God's will for me and the power to carry that out

Will do.

12. Having had a spiritual awakening as the result of these steps, try to carry this message to other addicts, and to practice these principles in all my affairs

Here, you have it.


I guess completing nine steps in 30 minutes is a good start. ;-) What cute kittens! I wish you could see them...

Because I'm Worth It

(I used to work for L'Oreal, by the way, in my pre-vicious momma life.)

There is a price for availability. Nothing is free. I've said this before, I think. As you might have noticed in the last post, Vicious Momma has a new rule. "No free rides- ass, grass, or gas." (that order is negotiable ;-) ) I've realized that I do an awful lot of things for "free" that many people get paid, often large sums, to do. So, I'm taking some advice from someone and raising my price. If there is a long line (and there is actually) then the price is too low. That is the principle upon which this advice was given. Well, hell, let's try it out and see if it works.

Anyway, I've been moping around lately needing some motherly nurturing. I need to go see my "hired mom" (counselor). I pay her $80 (thereabouts) to be motherly for 50 minutes. She gives support and good advice, just like my mom used to do. For whatever reasons (actually, the cost was one consideration because almost a thousand bucks a year is a lot of money) I haven't been maintaining my monthly appointments with her for probably most of this year, and I'm suffering for that.

She frequently has told me that I am worth more than I expect and she has wondered why I don't value myself more. Well, there's neither the time nor space to explain all of that right now. ;-) One day I surprised her. Our session was much more intense than usual because I finally lifted a different part of my mask and showed her a new mess underneath. She had no idea I hid such a chaotic wreckage of guilt and conflict. I hide it well sometimes, even when I'm supposed to be showing it. See, the fear is that even someone paid to look would be so annoyed, disturbed, horrified, bored, uninterested or whatever that they "quit" me. Actually, I think the fear of abandonment is the primary root of all insecurities and problems. Not sure who said that first. Maybe I'll look it up later.

In thinking about what today's sermonette would cover I decided to consult the great oracle box: the TV. Since I like to think that I'm 'attuned' to the underlying currents I thought I'd check and see what the TV preachers were talking about today. Well, wouldn't you know it? The first sermon I found was about value and self worth and all of that. Coincidence, you say? Heh, whatever.

I'm in a bit of a hurry today so I didn't listen too long to the sermon because I got the confirmation that I needed pretty quickly. And don't we all love when that happens? I sure do!

Anyway, this preacher was talking about how if we don't value ourselves then we are not valuing God. By hating or rejecting ourselves we are hating and rejecting God and all the things He has done for us. I missed the scriptures he used to back up his statements, but I've listened to this guy before and he's pretty good so I trust that he's not just blowing smoke. His basic point was that if God didn't value us then we wouldn't have all of this (life, the world, and so), and so in order to please God we should value ourselves, each other, and the world.

That jealous God of the Old Testament just wanted to be appreciated and recognized. Much like anyone else who does so much for "free." In trying to get man's attention he did many things, most notably, sending his Son to die for man's salvation. "For God so loved the world..." (John 3:16) In God's efforts to show us how much he values us he also realized that we humans tend not to value those things that are free. So he set one condition, or price, for our salvation. No more free rides, He said. You see, even God doesn't give free rides, so why should I? Indeed, there is a price for all of life. And if we don't value ourselves, no one else will.

I think I have an appointment to make soon... And that's today's Sunday Sermonette.


Afterthought: Like Stephen Hawking, I know the mind of God. And let me tell you, it's very interesting but only in finite portions. ;-)

New Rule

make your own neon sign

Mood Music Redux

Okay, here's another music themed meme. I'll do a random list like the other.

Tell us your favorite songs/types of music for...

1. Getting in the mood to party: "Love Me or Hate Me" by Lady Sovereign

Funny! I love this: "Love me or hate me, it's still an obsession, love me or hate me, that is the question, if you love me then Thank You, if you hate me then Fuck You"

2. When you're depressed: "The Last Thing On My Mind" by Neil Diamond

Wow, that's fittin'. "Well I could have loved you better, I didn't mean to be unkind, You know that was, The last thing on my mind."

3. When you're in lust: "Saved By Zero" by the Fixx

Okay, that is just weird.

4. Exercising: "Morningside" by Neil Diamond

Not good for exercising at all. Too slow.

5. Driving/riding in the car: "Never There" by Cake

That's pretty good.

Update: I decided to go ahead and make the same list, but not with songs randomly selected for me. Here is my intentional list:

1. Getting in the mood to party: "Sexy Back" by Justine Timberlake

I love this song and it always puts me in a better mood.

2. When you're depressed: "Black" by Pearl Jam OR "Sweet Caroline" by Neil Diamond

The first is what I listen to if I want to sink as low as possible, but the second is what I listen to if I want a pick-me-up.

3. When you're in lust: "Sexual Healing" by Marvin Gaye

"And when I get that feeling
I want Sexual Healing"

4. Exercising: "Love Rollercoaster" by the Ohio Players

Not too fast, not too slow.

5. Driving/riding in the car: "Panama" Van Halen

"Ain't nothin like it, her shiny machine.
Got the feel for the wheel, keep the moving parts clean."

Waiting

Finally, a new tarot card!

And the timing of its creation is of course, perfect, in so many ways. ;-) That it has taken oh, how long (about a year and a half?), to get the inspiration for it would be enough to make its nature so appropriate, but it also fits well with the current environment in other realms of life. I'm not sure but maybe all art is that way. But, anyhow, like Tom Petty says, The Waiting really is the hardest part.

What does it mean, "waiting"? I think it's our most intensive experience of the duration, or passing, of time. We are rarely as aware of time as when we are anticipating something. Indeed, waiting is probably the reason we humans started counting time in the first place.

This card, the 7 of orbs (pentacles in traditional decks), generally depicts a farmer waiting for his crop to be ready for harvest. But I started with a picture of the lemon tree and highlighted 7 of its many still unripe lemons this late into the season. I'm still waiting for them to ripen so I can squeeze some lemons ;-), but I fear they will just wither on the tree. Wasted energy? Wasted hopes and disappointment? Waiting can really test our faith. We never really can know if our efforts will pay off in the future or if we've worked in vain. Sometimes the wait for results is longer than we are comfortable with and that makes us pessimistic that we'll get any results at all. It's all up in the air. When there is such uncertainty it is easy to begin to feel like your work is done whether or not you see any results. Maybe you already got some results (the journey and not a 'destination') that aren't so obvious. Sometimes the process is more important than the outcome. On the other hand, the uncertainty of waiting can make us and others question our methods and goals. Part of the Seven of Orbs tells us that only time will tell and that we should practice patience with ourselves and with others. We all are waiting for something, and ultimately we are not in control of the outcome. But we are in control of how we wait and how we react when our waiting is finally over.

Just for Fun

Borrowed this from Kat.

1. You get to live the life of a character in any book. Who’s life would you live??

Any book? I can't think of any because I just don't read much fiction. Well, "Snow White and the Seven Dwarves" just popped into my head, but that is probably a little too close to my real life since I have to take care of four other people already. Oh, I know! I would be God in the Bible. ;-) LOL

2. I am taking you out to dinner. My treat, and the sky is the limit. What do you order, and where do we go?

Really, I'm not hard to please and don't require expensive meals to eat well. I would enjoy trying some new kind of food as long as it's not too exotic (no bugs or anything like that) or hot and spicy (I have a sensitive palate).

3. You have to eradicate a color, a number, a letter and a vegetable from this planet. What would they be, and why??

Do I have to? I don't think I could eliminate any color without that totally screwing up the visible light spectrum, or would it? Maybe I could kill "invisible" if you count that as a color. ;-) And I know of no number that we could live without. Just can't do it. The letter Q is probably not completely necessary, but I'd hate to kill it. And I agree with Kat about turnips. Ick. Kill them all!

4. You get to have a whole day to yourself, and spend as much money as you want. What would you do?

Buy a few more days. ;-)

5. You are another race. What did you choose and why?

I'd be Native American because I've always felt a strong affinity to their culture and everything ever since I can remember.

6. You get to decide the religion of the world.. everyone will follow it. What would it be?

See the answer to question number 1. LOL It would be Rae Annism. (waiting for the lightning bolt to strike)

7. I give you a pencil, paper and wave some creative faerie dust on you, what do you make?

The Answer to All Questions.

8. If you could go back in your life, what would you change??

I would have bought the houseboat I wanted right after I got out of college. I've never really lived totally on my own.

9. Your life is falling apart. Seriously falling to pieces.. no dramatics. You are losing your job, your house, your spouse, everything is on the verge of crashing. What would you do?

Pick up whatever pieces I wanted and start over. What else can you do?

10. Just for fun, you get to ask any question to me. And I will try my best to answer. What will you ask?

Who am I asking what? I'm tired of asking questions. Just give me some answers, dammit. ;-) But feel free to ask me anything, and I'll give you some kind of answer. lol

Random Soundtrack

Here's a fun new game. Open your electronic music library (from your iPod, WinAmp, Media Player or whatever), put it on shuffle, then play. Each successive random song from your library goes to the next question or event on the list. Here's my totally random list:

Opening Credits: "(You're The) Devil in Disguise" by Elvis (Great beginning! lol)

Waking Up: "Don't Leave Me This Way" by Thelma Houston (interesting mental pictures)

1st Day at School: "Strawberry Letter 23" by the Brothers Johnson (kind of strange)

Falling in Love: "Oceans" by Pearl Jam ("hold onto the thread")

Fight Song: "Hair of the Dog" Guns N Roses version (perfect!)

Breaking Up: "You Dropped A Bomb On Me" by The Gap Band (heh)

Prom: "Under the Milky Way" by The Church (kind of cool)

Life: "Please Don't Go" by KC and the Sunshine Band (weird)

Mental Breakdown: "Ridin'" by Chamillionaire (hilarious!)

Driving: "What's Love Got To Do With It?" by Tina Turner (potentially a dangerous driving song, lol)

Flashback: "Thank You" by Dido (kind of sweet)

Getting Back Together: "Wasted On The Way" by Crosby, Stills & Nash ("So much time to make up, everywhere you turn, time we have wasted on the way")

Wedding: "Nice To Be You" by Gallery (that's a good wedding song)

Love Scene: "Saved By Zero" by The Fixx (quirky)

Birth of Child: "Naughty Girl" by Beyonce (not a good fit at all)

Final Battle: "Love Machine" by The Miracles (make love not war, lol)

Death Scene: "Calling Doctor Love" by KISS (well, that's an odd death scene song)

Funeral Song: "Better Be Good To Me" by Tina Turner (that is WAY off for a funeral)

End Credits: "Our Lips Are Sealed" by the GoGos (kind of anticlimactic)


Some of that worked out nice, and some didn't. But I think Quentin Tarantino and I could write a funny script around it. ;-)

Ramble On (Page/Plant)

Leaves are falling all around,
It's time I was on my way.
Thanks to you, I'm much obliged for such a pleasant stay.
But now it's time for me to go.
The autumn moon lights my way.
For now I smell the rain, and with it pain, and it's headed my way.
Sometimes I grow so tired, but I know I've got one thing I got to do...

Ramble On, And now's the time, the time is now, to sing my song.
I'm goin' 'round the world, I got to find my girl, on my way.
I've been this way ten years to the day, Ramble On,
Gotta find the queen of all my dreams.

Got no time to for spreadin' roots,
The time has come to be gone.
And to our health we drank a thousand times, it's time to Ramble On.

Ramble On, And now's the time, the time is now, to sing my song.
I'm goin' 'round the world, I got to find my girl, on my way.
I've been this way ten years to the day, Ramble On,
Gotta find the queen of all my dreams.

Mine's a tale that can't be told, my freedom I hold dear.
How years ago in days of old, when magic filled the air.
T'was in the darkest depths of Mordor, I met a girl so fair.
But Gollum, and the evil one crept up and slipped away with her, her, her....yeah.

Ramble On, And now's the time, the time is now, to sing my song.
I'm goin' 'round the world, I got to find my girl, on my way.
I've been this way ten years to the day, Ramble On,
Gotta find the queen of all my dreams.

Gonna ramble on, sing my song.
Gotta keep-a-searchin' for my baby...
Gonna work my way, round the world.
I can't stop this feelin' in my heart
Gotta keep searchin' for my baby.
I can't find my bluebird.



Like all other traveling minstrels the Bittersweet Symphony of life is calling me down the path. This happens when your work is done in one town. It's a gypsy's life. Time to Ramble On...

Assumptions and Saviors

Today's Sunday Sermonette will be especially brief. We've discussed the nature of reality and whether or not we can rely on certain assumptions and if our "reality" is all there is or if there is some other reality outside of what were experience. Personally, and this is probably a religious assumption, I think that there has to be a reality outside of what we experience. It really seems pretty obvious even when you try to say that "it's all in your head" and so on because your head has to be somewhere too. ;-) There is Something Out There. I have faith in that assumption.

But in real, everyday life some assumptions are pretty dangerous. There's an old saying that goes something like, "Never assume anything because it makes an 'ass' out of 'u' and 'me'. Sometimes that's true. I try not to make many assumptions about other people because I don't like being made an ass. And in real, everyday life we need more 'evidence' to back up whatever assumptions might be considered necessary for progress. I can (hopefully) assume that my children will still love me even when I have to fuss at them. But with many people it is difficult to maintain assumptions if they don't engage in any kind of communication one way or another.

Unfortunately, at this particular moment I can't deftly weave saviorism with assumptions so just trust me that they are related somehow. Saviors are faced with a dilemma after they have done their savioring. Jesus had to be crucified. In fact most saviors seem to end up getting killed. That's kind of a shame, but I guess that's the best way to make an impact or point, well, as long as you have a sizeable audience. Without that, it's kind of a waste. And once people have been 'saved' they tend to get lazy about expressing their feelings about it. I guess maybe they've just assumed that they've been saved and that there isn't anything left to work out.

Well, I had some really brilliant points that I just can't remember now so I should probably leave it with this.

Have you hugged your Savior today?

And that's today's Sunday Sermonette.

Backfire

Greetings from North Carolina. I have insomnia which is definitely not what I was planning for this weekend. I should be sleeping soundly without the possibility of some small person jumping in the bed, "momma, momma..." at some ungodly hour. But for whatever reasons I can't sleep despite a couple of different chemical assistants. Maybe it's the full moon. Maybe it's all those cute little kittens that I keep thinking about. ;-) It's hard work being sweet.

Maybe we should have found a Duke lacrosse team party to attend?

Call Me the Breeze

I keep blowin' down the road... (Lynyrd Skynyrd, "Call Me the Breeze")


Later today I'll be blowin' down the road to Durham to spend the weekend there with my friends. I'm getting a little "momma break" which is much needed. Everyone have a safe and happy weekend! I know I will!

Telepathy Explained?

In an interesting 23 minute podcast called How Human Brains Are Wired To Connect, Daniel Goleman, author of Emotional Intelligence (which I haven't read but have read about ;-) ) speaks about his new book, Social Intelligence. Much of what he discusses sounds kind of similar to The Four Agreements and Magic Words and Alchemy. ;-)

He begins by explaining that "social intelligence" is an aspect of "emotional intelligence." He briefly defines emotional intelligence as self-awareness, self-management, and "channeling" positive emotions leading to the social aspects of empathy and skilled interactions with others. It seems he is saying that social intelligence is a kind of subset of emotional intelligence, which makes sense enough and sounds kind of familiar. ;-) His ideas are based on the findings of an emerging field called "social neuroscience" that studies how social interactions affect neurology. He describes "mirror neurons" that act as "wifi" that connect the physiology of two or more brains. (though he doesn't explain how this happens, only that it does; maybe there's more of that in the book?)

Goleman suggests that anecdotes of "ESP" in long-term relationships could be explained by the brains of the people in close relationships forming the same cognitive associations due to their physiologies interacting over time. I think that this synchronicity is probably rather variable and that it doesn't necessarily take a long time to achieve.

Probably the main point of his talk is that physiologies/neurologies seem to interact in non-trivial ways that we haven't been scientifically aware of until recently. Of course, these ideas have been around for a long time, but it is pretty interesting that there is now scientific research looking at them.

Goleman also discusses what we can do to regulate our receptivity/projection of these neural signals. Sure, we've all known people who can either light up a room or suck all the energy out of it just by being there. Apparently, meditative practices strengthen the neural pathways or "circuitry" responsible for the ability to block negativity and project positivity, but Goleman seems to be moving away from the scientific and into the spiritual (or at least speculation) when he talks about the larger implications.

I can't say I am convinced about his application of these neurological insights to the broader issues of society such as social, political, and economic problems. When he starts talking about possible "altruism circuitry" that "wants" to improve relationships and social conditions and how modern life impedes positive interactions and world relations, blah, blah, blah, he kind of loses me. Let's get the science of the individual interactions figured out better before we go making big sweeping conclusions about society. He mentions "compassionate capitalism" and so on, but it sounds too much like sociological mumbo-jumbo to me. Not that I'm against such things, but I feel some resistance to this kind of mandating of morality in much the same way as I am resistant to most Political Correctness.

Another idea Goleman suggests is that prisons should do more to "reform the brains" of convicts. (Actually, that sounds a bit like A Clockwork Orange.) Well, I tend to think that the brains of convicts are probably less "reformable" and that is probably why they are convicts in the first place. ;-) However, it would be okay with me if they used prisoners for this kind of research, and if they got positive results then yay for them.

Despite these sociological problems I think I'd like to read this book just to see if it makes sense as it's presented. And I'd like to know more about the actual research because you can't always trust other people's interpretations of things. ;-)


For those who are interested in other podcasts check out Science and the City.

Domestic Pleasures

(photo from Domestications.com)

I think there's something wrong with me. I can't seem to look at a bed without thinking about sex. I had to go get my glasses adjusted today because they were too loose. The closest way to LensCrafters is to go through JCPenney's upper level housewares department. That entrance to the mall is lined with 8 or so beds all made up to display their latests styles of comforters, etc. I wonder how many other people see those beds and imagine having sex in them.

I've noticed that this also happens when I look at catalogs with bedding, like the Domestications catalog. While I don't particularly like many of the styles in that catalog, it doesn't keep my mind from putting me in those beds doing things that would keep me from noticing the bedding anyway. ;-) I really do think there has got to be something wrong with me.

Maybe it's my blanket fetish, but not a fetish in the perverted sense (I don't do nasty things with blankets). I had a security blanket (I think I've already told this story, so sorry if I have, but I don't feel like looking back to make sure) when I was a baby/young child. I gave it up when I was about 4 and a half in exchange for a bicycle. Well, that's when I stopped carrying it around all the time, but I do still have it packed away in a cedar chest. It was/still is yellow. I wore out the satin binding from rubbing it while sucking my first two fingers (which might account somewhat for my oral fixation*), but as long as I had my blanket I could survive anything. I still catch myself rubbing fabric, or sometimes my purse strap, between my thumb and forefinger when I'm nervous or bored or just about anytime. It's just one of those unconscious habits.

Anyway, I continue to collect nice blankets and throws, especially if they are silky, satiny, velvety, or otherwise soft and soothing. So I guess it would be kind of natural when looking at a nice bed to want to plunge myself into it, and the natural progression of that thought is to have someone else with me. ;-)


*One should not get overly excited about that statement as it is a broader generalization than what some might be tempted to imagine. ;-) Not that their imaginings wouldn't be partially correct (after all, this post is largely about sexual thoughts), but it would be a mistake to assume a too narrow meaning. For instance, I generally notice people mouths first and then their eyes, and I like to watch people's mouths when they are speaking.

What a Cute Kitten!

Not about kittens exactly, but funny nonetheless:





via Tayster's World.

Happy Halloween

Sometime Today

Whoever is the sixth visitor from now will be number 6969 on my Sitemeter. This lucky number should bring that person much good fortune in the near future. ;-)

Congratulations to a visitor in Shelby, NC, who at 6:44:39 pm 10-30-06 became visitor number 6969 while searching for pictures of Bratz dolls. However, this visitor probably has no idea of this great fortune because she (probably a she looking for doll pics and not a he, but I could be wrong) only viewed the November 2005 archive and not the main page. Oh well, this oversight won't change their good luck. ;-)