Thursday, December 07, 2006

DNA Message

AGAATGTAGGGCTAAGCGCTGATGGTACTTCGTGCGGCGT
CAATGGCGGATGCCCTTATGGTTGGCATGGTCCGTTCAATGGTCG
GCGCTCTTGTTGAGGATGGAGACATGTACCTTGTATCAATGCTG
GATGTAGTTTCAATGCTATAAGTTATGAGAGCGGCGATGCT
TTATCTTGTACTCGATGTCCTTATGGTCGGCGCTCTTATGGTCCTTG
CGGAAATGCTCGGCGGAGTTGTAGGCGCGATGGTTGAG
GATGTCATGGTTGATGCTCTTGTG

(I had to break it up into several lines so it would fit on the page. To decode it you'll have to return it to a whole, long string.)


Create and decode a message in DNA.

3 comments:

babay said...

DNA is base-4 code; unlike computer's binary code which has only 1 and 0, DNA has 4 letters.

Rae Ann said...
This comment has been removed by a blog administrator.
Rae Ann said...

baba,

0100100100100000011010000110000101110
1000110010100100000011000100110100101
1011100110000101110010011110010010000
00110001101101111011001000110010100101110

LOL, I had to delete the first time because I messed it up. ;-)