Out of Balance?

Update 2-19-07: Just noting an interesting 'predictive' occurrence. Not long after this post, banking and its shady practices became a big news story. Well, make of it what you will, but this kind of thing happens to me often, just not always so quickly and in such big, obvious ways. And the really funny thing to me in looking back at this post is how especially well the title fits with these new developments. ;-)

I just have to rant a little about this stupid global warming crap with which groups like Greenpeace are polluting the world. Directly from their website (their bold emphasis):

We're seeing the effects of global warming all around us - more intense heat waves that disproportionately affect the elderly and poor, more severe storms that wreak havoc on our homes and communities, and all kinds of changing cycles in the natural world.

That's why it's unacceptable for the U.S. government and oil companies like ExxonMobil to continue to fuel global warming while refusing to support solutions to the problem. Fortunately, a clean energy revolution is sweeping across the country-we have the tools to put the Earth back in balance, and we can do it today.

Is that first paragraph not an obvious bunch of inflammatory lies meant to frighten and upset people? They should be sued for wrongful anxiety or something. And wow, "changing cycles in the natural world"? Since when did the cycles in the natural world not change? The Earth has never been a utopian paradise in some ideal "balance". That it was and that we in the last 100 years have ruined it is the biggest and dumbest and falsest myth of the whole global warming pile of bullcrap.

Now let me say one thing. I don't have a problem with a "clean energy revolution" as long as it doesn't involve some kind of communistic, socialistic, totalitarian regime imposed on unwilling people. I can't trust Greenpeace to follow those criteria because we all know that they don't respect the rights of anyone who disagrees with them. They clearly don't approve of choice unless the choices are the ones they have offered.

And why is ExxonMobil the only scapegoat bad guy here? It's one of the biggest publicly traded companies in the world, number 6 according to this Forbes list. What too many people don't stop to think about is that if you hurt a large publicly owned company you are hurting everyone. Well, it's just like global warming, right? ;-)

Let me go off on a little tangent here about the top five on that list.

1 Citigroup United States (Banking)
2 General Electric United States (Conglomerates)
3 Bank of America United States (Banking)
4 American Intl Group United States (Insurance)
5 HSBC Group United Kingdom (Banking)

Banking and Insurance. Yeah. Like those are pristine industries that do nothing to harm and exploit the poor and elderly and the environment. If I were a well-paid journalist I'd do a fancy, in-depth expose on those industries in comparison to ExxonMobil, and I suspect that the results would show that overall ExxonMobil is a choirboy in moral comparison to the evil that the banking and insurance companies do to all of us. But I'm not a well-paid anything. I'm just a random blogger, so sorry, I can't invest the time and energy on that project for free. I'm a capitalist at heart. ;-)


Militant Environmentalist Squirrel


It's easy to pick one company or person or thing to be a culprit, or boogeyman, that must be defeated. I sure hope that ExxonMobil isn't defeated by some squirrelly (by the way, I kind of hate squirrels) environmentalists. From what I've read they provide their employees with excellent benefits. On top of that imagine how much money is being earned by these people and how they in turn put that into the economy. Greenpeace and all the other people who vilify ExxonMobil need to realize that picking one company to blame imaginary problems on is just plain wrong.

Well, despite whatever those wackos say, the Earth is not out of "balance", and even if it was there is nothing that humans (or militant environmentalist squirrels with guns) could do to change it.

Still Around

Sorry I've been scarce the last few days. I'm still around, just kinda busy.

Constitutional Study: Congressional Powers

Article 1

Section 8

The Congress shall have Power To lay and collect Taxes, Duties, Imposts and Excises, to pay the Debts and provide for the common Defence and general Welfare of the United States; but all Duties, Imposts and Excises shall be uniform throughout the United States;

To borrow Money on the credit of the United States;

To regulate Commerce with foreign Nations, and among the several States, and with the Indian Tribes;

To establish an uniform Rule of Naturalization, and uniform Laws on the subject of Bankruptcies throughout the United States;

To coin Money, regulate the Value thereof, and of foreign Coin, and fix the Standard of Weights and Measures;

To provide for the Punishment of counterfeiting the Securities and current Coin of the United States;

To establish Post Offices and post Roads;

To promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries;

To constitute Tribunals inferior to the supreme Court;

To define and punish Piracies and Felonies committed on the high Seas, and Offences against the Law of Nations;

To declare War, grant Letters of Marque and Reprisal*, and make Rules concerning Captures on Land and Water;

To raise and support Armies, but no Appropriation of Money to that Use shall be for a longer Term than two Years;

To provide and maintain a Navy;

To make Rules for the Government and Regulation of the land and naval Forces;

To provide for calling forth the Militia to execute the Laws of the Union, suppress Insurrections and repel Invasions;

To provide for organizing, arming, and disciplining, the Militia, and for governing such Part of them as may be employed in the Service of the United States, reserving to the States respectively, the Appointment of the Officers, and the Authority of training the Militia according to the discipline prescribed by Congress;

To exercise exclusive Legislation in all Cases whatsoever, over such District (not exceeding ten Miles square) as may, by Cession of particular States, and the Acceptance of Congress, become the Seat of the Government of the United States, and to exercise like Authority over all Places purchased by the Consent of the Legislature of the State in which the Same shall be, for the Erection of Forts, Magazines, Arsenals, dock-Yards, and other needful Buildings;--And

To make all Laws which shall be necessary and proper for carrying into Execution the foregoing Powers, and all other Powers vested by this Constitution in the Government of the United States, or in any Department or Officer thereof.

Well, since I am a Constitutional Fundamentalist I must admit that, indeed, Congress does have the final say about War. Whether people agree or not, it is clearly stated in the Constitution what the rules are. I don't really see where there is much controversy or question about it.

In regards to Iraq, my personal feelings about it are that it would be irresponsible and immoral for Congress to hastily withdraw funding for the war. I don't know what the best answer is because I'm not a military or stategic expert. But common sense kind of says that withdrawal isn't really the easy option that some make it out to be.

And I'm pretty much disgusted at all the Congresspeople who are hollering about their "20/20 hindsight" about their previous votes for the war. Of course, we all can name many things in our pasts that we would have changed had we known then what we know now. It's completely meaningless for people like John Edwards to jump up and say that they have changed their minds now. You can't go back and change what you did. Just accept it and move on.

Anyway, regardless of my individual feelings about it I have to accept the final decision of the representatives of my fellow citizens. This is the way it works in America. Sometimes you win and sometimes you don't. And when you don't, it's always best to move on instead of whine and complain about your loss, or to flippantly say you've changed your mind in hindsight.

---------
* written authority granted to a private person by a government to seize the subjects of a foreign state or their goods ; specifically : a license granted to a private person to fit out an armed ship to plunder the enemy

Hey, how can I get one of those? ;-)

Old Stuff: Sticky Notes and a Bible

Did you know that some Post-it notes last for decades and don't lose their stick? Here is proof...



Twenty year old Post-it notes. (inset with clear date) For real. And they still stick just as well as brand new ones. I bought these in 1987 at a paper supply store where I worked for a summer job. I thought they were cute then, but I think they are even cuter now. ;-)

As you can kind of see in the picture my "Pure Bull" notes are used as place markers in a Bible. That's just kind of my own personal ironic joke, but feel free to be amused if you are so moved. ;-)

This is actually my favorite Bible. I received it in 1976 when I was Baptized. It is the "Good News Bible" in Today's English Version and has very groovy 70ish illustrations:


This illustration of Jabob's Dream/Stairway to Heaven had inspired me with a sermonette a few days ago, but the idea has vanished now. So much for Hawking's Information Paradox. ;-)


This has been called a "liberal" translation by some, but it doesn't really matter to me either way. I can read the King James version too. This Bible has a lot of nice extras like maps of the ancient world, a chronology of the Bible, passages from the Septuagint (ancient Greek translation of Old Testament), and various indeces.

Thanks Bee!

I am: a file cabinet Reams and reams of information that just might need to be retrieved and looked up some day, stored in a convenient low-tech form that everybody can read or produce easily.

Which office supply are you?

This was a really fun quiz! And pretty accurate too.

Cool and Creamy

You Are Strawberry Ice Cream

A bit shy and sensitive, you are sweet to the core. You often find yourself on the outside looking in. Insightful and pensive, you really understand how the world works. You are most compatible with chocolate chip ice cream.

What Flavor Ice Cream Are You?

Self Portraits

I'm not sure why most artists tend to do a lot of self portraits. Maybe it's because when you need a subject that is the easiest one to get. Maybe it's some kind of obsession with trying to make yourself into the image you wish you were instead of the one you are. Maybe it's to remind your kids what you looked like when you were a certain age. I don't know, but here are some I did today:


I like this one.

This one is okay, but I think I look kind of old.

This is just a photo very similar to the above but slightly different and with no special effects.

Vintage: 1968

Usually, when we think of the year 1968 we probably think of assassinations (Martin Luther King, Jr. and Robert F. Kennedy), the Vietnam War, hippies, anti-war protests, and other social unrest. But just like any other year there were plenty of normal, peaceful, common events such as the birth of a baby. One of those babies was born to a happy couple on January 25 and was named "Rae Ann" a couple of days later.

By the way, why isn't my birthday listed in the Wikipedia article? ;-) I'm kidding, of course. But I am the number one (and two, at the moment) "Rae Ann" on Google even ahead of a Hospital named Rae Ann, which is really weird because I'm just some housewife in Tennessee. LOL But what is really weird is that most people I interact with in "real" life have no idea about this.

If you're curious about other products of 1968 here are a few things. If you like wine, especially pretty old wine, and have a lot of money you could try some of these. Apparently, 1968 wasn't a great year for wine though. Oh well.

It was a great year for music. My mom used to talk about how I'd bounce in my carseat to Marvin Gaye's "Heard It Through the Grapevine" which has been overlooked in the above Wiki article despite its being a #1 hit late in the year. Other favorites from 1968 are "Sunshine Of Your Love" by Cream, "Hello, I Love You" by The Doors, "Born To Be Wild" by Steppenwolf, "Hey Jude" by The Beatles, and "(Sittin' On) The Dock of the Bay" by Otis Redding, among others.

If you like muscle cars then 1968 was a pretty good year. However, the best cars from that year are the Chevrolet Corvettes which aren't listed as "muscle cars" in the Wiki article because I guess they are more considered "sports cars", whatever the difference might be.

Well, it's a good thing that David is particularly fond of 1968 vintages. ;-) Several months ago he bought this:

Yes, it's a 1968 red Corvette.

"His and Hers", sorry that the garage is such a mess but the other detached garage is being finished inside and so a bunch of stuff had to be moved temporarily into the this garage.

When he bought this car it was in good running condition (much like me when he first "got" me, lol) but it is a "project car" and he has dismantled much of its insides so he can truly restore it. The car's insides are now about as bad a mess as my insides. ;-) But unlike me, it will be worth pretty big bucks after it is fully restored. To fully restore me to "mint" condition would probably be impossible, but if you tried you'd have to spend a whole lot more money than to restore this lovely automobile.

Here is a nice shot of the quintessential, iconic, curvacious shape of the Corvette that is probably what most people think of when they hear about Corvettes. This is the C-3 body style that was produced from 1968 to 1982, which is kind of a long time for a car to keep the same body style.

Well, it's tempting to ask myself, "When did I get so old?" But really, the answer to that question is pretty easy. All I have to do is look around at my life and see all the wonderful blessings that can't be any kind of "instant" results, but are truly the products of many years of hard work, struggles, and also good times. I have a really great life and for that I'm eternally grateful to the Universe and the people who have loved me. I'm happy to be beginning my 39th year, and I hope to have at least 39 more happy years ahead of me.

Feeling It

This week contains the Most Depressing Day of the Year. It is today, and I'm feeling it.

Last year it was tomorrow.

However, this Thursday might be a little happier, I hope. ;-)

Vicious Grandma

This is my paternal grandmother in 1951, age 37, so she wasn't a grandma yet. She was an amazing woman who was a big inspiration to me. She was killed by a drunk driver on Jan. 20, 1990, when he plowed his car into the car she was in. It was a devastating loss for the whole family. She would have had many, many more years of good health ahead of her.

Growing up my sister and I would spend a week or two with our grandparents in the summers. Partly, I guess, to give our parents a little break from us, but also to help us get to know our grandparents since they lived a few hours away and we didn't get to see them often throughout the year. We have so many fond memories of those summer visits.

She got her first modern washer and dryer in 1977 or 1978 (I can't remember exactly now). Before that she used one of those wringer washers. I think hers was electric and not hand cranked. The one in the link is a remake, and believe it or not, I would kind of like one, though not to replace my modern one. ;-) I was fascinated by watching her feed the wet clothes through the wringer, but she wouldn't let me help because she was afraid I'd get my fingers or hand caught in it. Maybe she was just like me in that she liked to be in control of the laundry and didn't want little hands messing things up.

In high school for my senior year Spring Break, unlike most of the other kids who went to the beach to party, I spent the week with my grandmother. My grandfather had died in 1979, and Grandma never remarried though she did have a series of boyfriends-usually younger by several years because the men her own age couldn't keep up with her. ;-) This week with her was priceless and very important to me.

She loved to drive all over the rural area to visit with friends and family. I got to meet people and see places that I never otherwise would have seen. Some of these were kind of unbelieveable because of the abject poverty conditions, yet these people were warm, friendly, and wise. I'm talking tar paper shacks here, with crooked linoleum floors and crooked, unfinished walls and no heat other than a wood stove. And in rural Appalachia there are still people living in this way.

We went to several different backwoods Baptist churches that were having Revivals. Every night was a different one. Incidentally, this is the same grandma who had me recite a bible verse in front of her church when I was quite young. I remember being impressed with the passionate delivery of one preacher who was barely literate yet understood his interpretation of the Bible to a degree that many highly educated preachers don't seem to reach. He truly seemed to be channeling the Holy Spirit. At another, I was moved in some other deeper, more vague way. It has been these experiences, among some others, that have kept me from accepting atheism.

During this Spring Break she also taught me to pick "creases" which are a wild green of the cress family that were delicious when she cooked them. I see them growing around here and am always thinking of picking them and eating them, but there is that small part of me that is kind of insecure and worries that I'll do something wrong.

My grandmother was a storehouse of knowledge about family history, nature and plants, and probably many other things that I didn't get a chance to learn. She always seemed fearless and almost brutally practical. I think she'd have gotten a big kick out of being called a "vicious grandma."

Mmm Pie

You Are Mud Pie

You're the perfect combo of flavor and depth Those who like you give into their impulses

What Kind of Pie Are You?

With Two Rs...

Your Stripper Song Is

Dirrty by Christina Aguelera "Too dirrty to clean my act up If you ain't dirrty You ain't here to party" You're so dirty, you make Christina look clean.

What Song Should You Strip To?

Widget Idget

I need help with adding some of the new blogger features, such as a list of post labels. The new template code looks nothing like the old one and I'm just not up to trying to figure it out. So if there is any generous soul who would like to help me, please do. Thanks.

Illness Update

I just got back from a recheck of my lung at the doctor's office. The pneumonia seems to be mostly cleared up now, and the pleurisy is completely cleared up. So that's good news, but I'm still pretty weak and easily breathless. But that should also improve over the next week or so. There is one spot of something that could be scarring or some other relic of this illness that they want to check again in the future. Well, it's probably nothing, but considering my family history I am having to seriously consider giving up my favorite guilty pleasure (not blogging, that's my second favorite ;-) ). As enjoyable as it is, it's not worth dying for. Maybe it's time to just grow the hell up.

What the Sun Told Me

I just love this picture of the sun. Thanks, Bee, for reminding me of it.

I was hoping that it would inspire a nice Sunday sermonette about the Source or some such thing, but it just didn't come.

Then I thought it could maybe bring out some hellfire and brimstone, but that failed me too. (you know something's wrong when I can't even get some hellfire and brimstone going)

The Sun shared some thoughts with me, but I just don't feel like giving away my secret wisdom today. Sorry. ;-)

So in lieu of a sermonette today, I'll leave it up to anyone else who feels inspired to share what the Sun tells them.

I really mean it. I would love to hear someone else's thoughts for a change. ;-)

Sedentary Living and Global Warming

I just got a laugh from this article about a new, serious disease that is even recognized by the World Health Organization:

Get Moving!

(by Carol Krucoff)

Professor Frank Booth, Ph.D, was out for his daily run one spring morning in 2000, pondering one of the toughest problems facing public health officials these days: how to get the nearly 70 percent of Americans who don't regularly exercise to start moving.

"Everyone knows exercise is good for them, but many don't realize it's a matter of life and death," says Dr. Booth, who teaches biomedical science at the University of Missouri-Columbia. "My father was in advertising, so I know how important a short, catchy name is to grab people's attention and change the way they think and behave. Running always helps my creativity, and the name Sedentary Death Syndrome just popped into my head."

Sedentary Death Syndrome (SeDS) may be a little too scientific to be catchy. But it needs to catch on. Because what it means, says Dr. Booth, is that "inactivity kills."

Dead Man Sitting
In fact, sitting kills more than 300,000 Americans annually. If it were a real disease, that would make SeDS the third leading cause of death in the United States, right after heart disease and cancer. But SeDS is more than one disease. Being sedentary is linked to a wide range of debilitating ailments -- from diabetes and depression to osteoporosis, certain cancers, and even sexual dysfunction. It affects nearly three out of four adults and a growing number of children and is projected to cost the United States $1.5 trillion over the next 10 years.

Though it's not yet a household word, the SeDS concept has caught on with a growing number of exercise scientists. Dr. Booth used his own money to start "Researchers against Inactivity-Related Disorders," or RID, an organization advocating governmental support for research into the disorders associated with sedentary living. A founding group of 40 RID members unveiled the concept of SeDS on Capitol Hill in 2001. Today, the group has more than 400 members in 19 countries.

(Just sitting around is apparently a worldwide phenomenon. Last year, the World Health Organization announced that about 2 million deaths annually worldwide are attributed to sedentary lifestyles and chose physical activity as the theme for World Health Day.)

Uh, yeah, I think the most revealing phrase in the entire article is "RID, an organization advocating governmental support for research into the disorders associated with sedentary living." We all know what "advocating governmental support for research" means: we want money, money, money! Oh, boy, someone has discovered a new source of pork-spending. They've created a new lobbying group disguised as doctors and researchers concerned for the health of all the people sitting on their asses (writing blogs and reading blogs and stuff, ;-) ). But the real truth of it is that this is just like the global warming scare that some people have created and perpetuated for their own job security and wealth. This new "SeDS" group is taking a page right out of the global warming playbook and working to create a huge public health scare.

I mean, this could be a scary statement for some people: "sitting kills more than 300,000 Americans annually." Wow! Just from sitting. ;-) If this isn't some kind of alarmist scare tactic like Gore saying that we have about ten years until the Earth is uninhabitable unless we all immediately go back to living like in the Dark Ages (well, except for him and all the other "important" people, just like when the Communist leaders lived in luxury while the "people" lived in poverty). And then get this, "[sedentary living] is projected to cost the United States $1.5 trillion over the next 10 years." Trillion. They really have set their sights pretty high, haven't they? These are some high maintenance "researchers" who must have some big mortgage payments to think about. ;-)

Unfortunately, there is some grain of truth to this "SeDS" in that our lifestyles have changed and some people apparently aren't adapting too well to those changes. But this grain of truth gets turned into a mountain just like the way a warm winter gets turned into climate change. Is this really something that can be fixed? I'm kind of thinking that on the larger societal scale, no, it's not something that can be eliminated like small pox, unless someone invents a perfect health pill and/or instates the Health Police. (actually, the Health Police are already trying that with the no smoking laws and now the no transfat laws some cities are passing)


The Health Police were too late for this fella.
Photo found on this hilarious site: Pushin Daisies: a mortuary novelty shop, though it looks like this particular item is no longer available, oddly enough.

Besides, I really question some of their "facts" about what really makes people unhealthy and kills them. I keep hearing about all these famous athletes getting cancer and bad arthritis and all the same things that regular people get. Yeah, all that healthy eating and exercise didn't keep them from getting sick, did it?

Just look at the commercials on TV. There's another key to this story: poor health is big business. We are constantly being told that we are depressed, full of mucus, impotent, too fat, allergic to everything, sleepless, asthmatic, hypertensive, full of cholestrol, and have acid reflux, ADHD and enlarged prostates (men) and leaky bladders (women). But all we have to do to get better is take these expensive pills. Now seriously, are we supposed to believe that this "RID" group really wants to kill their cash cow? I see right through their ruse.

Another big money maker for doctors is colon cancer screening.* I remember the day when it was only the unethical and seedy doctors who advertised their services (but never on tv because tv ads are expensive), but now all the big practices have their pseudo public service ads telling us we all must go pay them (or if you're lucky your insurance will pay them) to stick a camera up our butts or we will die of colon cancer. Scare tactics, again.

And there is a part of me that asks why we should be trying to keep all these people alive longer anyway, especially if the world is becoming overpopulated with couch/computer potatoes who drive their gas-guzzling SUVs to the Dunkin Donuts for a 60 pack of donut holes and a dozen jelly-filled. ;-) Well, of course, the answer is that we must do as much as possible to keep filling up the doctors' and researchers' and lawyers' pockets.

I have to wonder if this isn't a matter that will take care of itself. Just like the climate.



*Hold onto your stones. There's no need to throw them. I know the seriousness of colon cancer and that screening can save lives. Thank you.

News of the Week

First of all I am so happy that the missing Missouri boy has been found alive. What great news! And even more miraculous is that another boy who had been missing four years was also found at the same place. It seems clear to me that anyone who preys upon children is subhuman and doesn't have the same rights as normal people.

On a much sadder note, two families here are mourning the most horrible murders of a young couple. Four black men are charged with the abduction and murders of a young white couple, 21 year old Channon Christian and 23 year old Chris Newsom.



Apparently, what started as a car-jacking ended up in two murders. The only reason I mention the race issue is because we all know that if it had been a young black couple murdered by four white men the crime would have been all over the national news just like the false rape of a black woman by however many white men (Duke lacrosse team case).

Well, my deepest sympathy goes to the families who have lost their beautiful children. I just can't imagine the pain and sorrow they must be feeling. And my sympathy goes to the families of the murderers, too, because it must be a very horrible feeling to know that your relative has done something so bad.

Lastly, on the person front, I'm suffering from pleurisy. It's probably the result of the bad cold (or flu) I had over the Christmas holidays, but I'm just guessing. I have to go to the doctor again on Monday to make sure it is responding to the antibiotics.

They gave me a bit of a scare yesterday after taking the chest x-ray. They immediately sent me to the hospital for a CT scan to make sure that I didn't have a pulmonary embolism. The good news is that I don't have that.

Have you ever had a CT scan? They are pretty cool, and the machine looks and sounds like something from a sci-fi movie. The freakiest part was the feeling of the contrast dye being shot through my veins.

Well, I must now go rest my sickly little self.

Illness Update: Spoke with the doctor Monday, and apparently I had pneumonia and didn't know it and so it progressed to pleurisy. I am getting better slowly. At least now I can breathe without pain. I don't know why I get so sick, except maybe I'm some kind of freak who wants to see just how sick I can get before going to the doctor. ;-)

Spiders on Drugs

Sorry to those who can't handle spiders, but this is hilarious and I wish I had created it:

Naughty Beardsley

Find more naughty Beardsley here.

And for not naughty Beardsley look here.

To learn about Lysistrata look at the wikipedia article.

This posting is in no way an anti-war statement. I just like the phallics in this picture. I'm such a simple creature. ;-)

Cute Singing Kittens

From the creator of the Spongmonkeys, here are the most adorable singing kittens:









And if you're not impressed by cute kittens, try this massive cock. Go ahead, it's work safe, I promise. ;-)

Freaky!

I really like to read Jonathan Cainer's horoscopes because they usually surprise me with a nice chunk of wisdom or some other thought-provoking thing. I was just checking tomorrow's 'scopes because he usually has them up early. I always check the Aquarius because that is my Sun sign, but I also check the one for Sagittarius because I have three planets or "signs" there (Venus, Moon, Ascendent or Rising Sign) which could make me more Sagittarius than Aquarius since I only have two planets/signs there (Sun and Mercury). This might not be an 'orthodox' method of checking horoscopes, but I guess orthodoxy isn't the biggest concern there. ;-)

Anyway, Tuesday's Sagittarius 'scope really freaked me out!

Tuesday, 9th January 2007

SAGITTARIUS
(Nov 23 - Dec 21)
'Put on a happy face.' 'Smile though your heart is breaking.' 'Pack up your troubles in your old kit-bag and smile, smile, smile.' The songwriters are unanimous. The thing to do when you find yourself in times of trouble is to let it be. To some extent this puts them in direct conflict with the psychotherapists who are strongly of the opinion that emotions must be honestly expressed at all times. Whose advice should you take? It doesn't much matter. Soon your problem will be fixed!

I bolded the part that is so freaky because just yesterday I posted the lyrics to the Beatles song "Let It Be." Do you think that Jonathan Cainer might be reading my lyrics blog? ;-) Or maybe Mother Mary came to him yesterday too? Wonders never cease!

By the way the Aquarius scope for tomorrow wasn't up yet, as of my writing this.

Memorial

Ten years ago about right now (well, not considering calendar irregularities) my mom died. In this picture she was about 30 and I was about 5. I'm about 95% sure this photo was taken in the summer of 1973. My mom was a hottie! I've always paled in her shadow, even ten years after her death. The occasion of this picture was showing off the little "Indian dress" she had bought me because I was so interested in Indians/Native Americans. She called me "Princess Feather."

I considered cropping this photo to remove the background junk, but I decided that it was interesting, if only for me, to see the old cars and whatnot. And dig that hair on Mom! Wow! Incidentally, my most vivid early memories are set in this time and place.

Wanderlust

Maybe it's this perpetual Spring that we are having this season, but man, I'm getting the wanderlust pretty bad. My eyes are longing for some new kind of scenery. Where should I go?

Dear Britney Spears,

I bet your mother is horrified. If she isn't, she should be. Let me do a little proper mothering here in case your own mother is that clueless.

First of all, nobody really wants to see your hairless privates. Well, maybe some idiotic males do, but they obviously would look at ANY privates so don't be thinking that yours are all that special.

Second, please wear underwear when you're wearing a skirt. This is for your and everyone else's health and safety. Nobody wants to sit on a seat that your naked privates have touched. Well, maybe except for those same idiotic males mentioned above. I don't care how rich and famous you are, your ass is still nasty. And even OutKast sang about that:

I know you'd like to thank (think) your shit don't stank (stink)
But lean a little bit closer
See that roses really smell like boo-boo (poo-poo)
Yeah, roses really smell like boo-boo (poo-poo)

And I guess you never considered wearing panties to protect your own privates? Goddamn, the world is full of germs. But I guess if you let K-Fed (and who knows what other man-skanks) down there then you don't really care about the health and cleanliness of your poontang. By the way, I saw the pictures of you going barefoot into a gas station bathroom. Oh Lord, girl, you are just plain stupid. Didn't your mother teach you anything?

I hate to say it, but you are not fit to be a mother. You need to straighten yourself out, stop hanging out with even bigger nasty skanks than yourself, and take some parenting classes.

You are a walking health hazard to yourself and everyone else. Toxic, indeed. What a waste of a pretty girl. I mean really, you've grown up in a world that worships youth and beauty that has given you all fortune you could ever want just because you were pretty. Did this teach you to value yourself? Obviously not if you're exploiting yourself in these most offensive and irresponsible ways.

And by the way, totally shaved is so 1990s. Grown up women and grown up men have body hair. Hairless privates (male and female) are for those with pedophilic tendencies. If someone isn't mature enough to know how to handle some hair down there then he or she isn't mature enough to have their face down there in the first place.

So, please, if you have an ounce of decency, take my words to heart. Grow up, be a good mother, and wear underwear!

Sincerely,

Rae Ann, Vicious Momma

PS (2-23-07) Oh, honey, you've really got to stop drinking and whatever other drugs you're doing. Can't you see that you are totally ruining your life? And the life of your two little kids? Please, stop focusing only on yourself and your own needs and impulses. You have got to think about your kids! Do you really want K-Fed to have custody of them? Everything you are doing now is being held against you. I know how hard it is to pick yourself up and face the big troubles of life, but you have to do it! You are strong enough. You don't want to end up like Anna Nicole. You are still so young and have so much life ahead of you. Please, go to rehab and STAY there until you are straightened out enough to be the responsible parent that your boys need. You have been through a lot in the last couple of years: having two babies very close is enough on its own to make a woman go insane. But you must be a grown up and face your responsibilities. It breaks my heart to see someone self-destructing in such a dramatic and public way. Stop. Look at your little boys and decide that you want to be the mother they deserve. You can't get back these days that you're wasting. Pray to God to help you have the strength to face reality.

About Saddam...

Saber Point: The Intellectual Dishonesty of the American Left

I've avoided writing about Saddam and his execution over the holidays, but today I read the above linked blog article that pretty well summarizes my thoughts and feelings about it.

It's kind of sickening that so many people are torn up over Saddam's hanging. I watched the video of the actual hanging, with the drop (link found at the Reference Frame).

I was most impressed with the grim darkness of the gallows and the apparent lack of ceremony and pomp that a dictator might have expected. The atmosphere was chaotic and I'm sure that only increased Saddam's discomfort and anxiety. One could probably imagine that his execution was rushed and premature, but what's done is done and it was done by the Iraqis according to their own design. Did the US have some hidden hand in it? I don't know and I don't really care. Conspiracy theories are a dime a dozen, and frankly now Saddam isn't worth even a dime.

You know, the same people who keep hollering that we should let Iraq do its own thing are the same ones who criticize their handling of Saddam (and many other things). Well, you can't have it both ways. You can't give people Independence and then demand that they still do everything the way *you* think they should.

I'm not celebrating a death, not even a dictator's death, but I'm not mourning it either. When someone willingly and criminally takes another life he has forfeited his own right to live.

Happy Hoe New Year!

Thanks to reader, Rafa, from Madrid, Spain, for alerting me to this Hoe poem and Hoe painting.

The Man with a Hoe

Bowed by the weight of centuries he leans
Upon his hoe and gazes on the ground,
The emptiness of ages in his face,
And on his back, the burden of the world.
Who made him dead to rapture and despair,
A thing that grieves not and that never hopes,
Stolid and stunned, a brother to the ox?
Who loosened and let down this brutal jaw?
Whose was the hand that slanted back this brow?
Whose breath blew out the light within this brain?

Is this the Thing the Lord God made and gave
To have dominion over sea and land;
To trace the stars and search the heavens for power;
To feel the passion of Eternity?
Is this the dream He dreamed who shaped the suns
And marked their ways upon the ancient deep?
Down all the caverns of Hell to their last gulf
There is no shape more terrible than this--
More tongued with cries against the world's blind greed--
More filled with signs and portents for the soul--
More packed with danger to the universe.

What gulfs between him and the seraphim!
Slave of the wheel of labor, what to him
Are Plato and the swing of the Pleiades?
What the long reaches of the peaks of song,
The rift of dawn, the reddening of the rose?
Through this dread shape the suffering ages look;
Time's tragedy is in that aching stoop;
Through this dread shape humanity betrayed,
Plundered, profaned and disinherited,
Cries protest to the Powers that made the world,
A protest that is also prophecy.

O masters, lords and rulers in all lands,
Is this the handiwork you give to God,
This monstrous thing distorted and soul-quenched?
How will you ever straighten up this shape;
Touch it again with immortality;
Give back the upward looking and the light;
Rebuild in it the music and the dream;
Make right the immemorial infamies,
Perfidious wrongs, immedicable woes?

O masters, lords and rulers in all lands,
How will the future reckon with this Man?
How answer his brute question in that hour
When whirlwinds of rebellion shake all shores?
How will it be with kingdoms and with kings--
With those who shaped him to the thing he is--
When this dumb Terror shall rise to judge the world,
After the silence of the centuries?

1899, Charles Edward Anson Markham (1852-1940)
Using the penname Edwin Markham

Markham was inspired by the 1863 painting "L'homme à la houe" by the French artist, Jean-François Millet (1814-1875), to write this poem.




If you think that guy is worn and tired, just imagine how his poor hoe must feel! ;-) Actually, I think he'd have saved his back some trouble with a longer handle on his hoe, but I guess back then they made do with what they could find.

Incidentally, this morning I watched part of a documentary about Afghanistan and was enlightened to see that even when people live in caves they have the same concerns and conflicts within their families as people who live in warm, comfortable houses. The wife was bitching at the husband about the same things I bitch about sometimes, and the older man was bitching at the younger man (not sure if the wife was this older guy's daughter) about going out and getting a job to help support the family. It is very weird to know that in the twenty-first century there are people still living in caves. It is another moment of realization at how good my life is and how thankful and appreciative I must be.

As we begin 2007 let's all reflect on the blessings we've received and be truly thankful for them. And let's hope that the New Year will continue to provide for us the things we need. And also, let's have compassion and empathy for those whose work is greater than ours and whose lives are harder.

Happy New Year!

PS I did ring in the New Year with a glass of premature lemonade, and it was pretty tasty!

Retrospection, 2006

So many things have happened this year, even if only in my mind ;-), that I can't possibly summarize it into a few paragraphs. It's just beyond my ability. So maybe I'll just pick and choose. ;-)

While thinking about 2006 the first thoughts were that it was the Year of Giving Until It Hurts. I know I've expressed this idea in other posts throughout the year, but I don't have time to go back and link them at the moment. I let myself feel the emotions of self sacrifice (and even some resentment) while recalling all the times I gave until it hurt. Then I was so overcome, to the point of tears, with the realization that I am so extremely Blessed in this life that the whole meaning of The Year of Giving Until It Hurts was transformed into something else, something Divine*. It wasn't only my giving. I've received so much that I have no right or privilege to complain about anything when it comes to my family life. And I am so very thankful for all of my Blessings. It is pleasantly humbling (like a "good hurt") to realize the magnitude of it.

So while I might feel like a doormat in some respects I also now know that I've got to be a really large, durable, and probably comforting doormat to be able to handle all the trampling of this past year. ;-) Perhaps I'm flirting with a Job kind of moment right now in that it's better to be thankful for all the good things in life instead of focusing on what was lost, taken away, or not given at all.

Oh, yeah, the Lemon Tree. For the ongoing lemon tree saga: critter updates, tree of life, tree of life update, waiting, and signs, etc.

I'm still waiting to squeeze those lemons. ;-) But the tree is blooming again! (sorry for the poor quality photo)



And this time there are at least four times as many flowers (many not visible in that photo). Since there are no bees or other bugs I don't know if there will be fruit from these blooms. If the tree self-pollinates maybe there will be. It apparently doesn't get enough light right now to fully ripen the fruit already on it. Well even so, I think I'll ring in the New Year with a glass of premature lemonade. What better way to celebrate this passing year and all of it's sweet and sour moments? After all, even though I hated the poster my college roommate hung on our wall I guess it convinced me anyway that when life gives you lemons, even half-ripe lemons, make the best of it and make lemonade!

So cheers to all and here's to celebrating and being thankful for 2006! And cheers to all and here's to a sweeter and less sour 2007!

Therefore encourage one another and build up one another, just as you also are doing. But we request of you, brethren, that you appreciate those who diligently labor among you, and have charge over you in the Lord and give you instruction; and that you esteem them very highly in love because of their work. Live in peace with one another. We urge you, brethren, admonish the unruly, encourage the fainthearted, help the weak, be patient with everyone. See that no one repays another with evil for evil, but always seek after that which is good for one another and for all people. Rejoice always; pray without ceasing; in everything give thanks...

1 Thessalonians 5: 11-18
New American Standard version

And that is this year's final Sunday Sermonette. Happy New Year!


Retrospection, 2005


---------------------------
* I'm truly sorry for those who cannot experience the Divine in that way. I think that part of the reason why some people refuse to acknowledge the Divine is because it is a kind of painful experience. It does hurt a little at first (just like some other things), but the feeling changes to a kind of rapture (just like some other things). Some people fear that initial pain so much that they won't even approach it. Well, as they say, what you don't know can't hurt you. But they also say, you never know until you try. Let me tell you, the more humble you are the less it hurts to be put in your place.

Christmas Pics

Prettiest girl in the world.


Cutest boys in the world.


Cute green bean bundles my dad made for Christmas Eve dinner.

Because I need a good laugh...

Most recent search terms that brought people here:

jose can you see magazine article title
corvette frame
movie quote: when i was younger, i used 2 think about it a lot and envision how it may have happened....
hoe much does a kitten cost
gay mechanics
bratx dolls
zz top i like your peaches
blanket fetish
what were you doing at midnight survey
hoe movie
slept with my boss married
shasta porn
shine on me dressbarn perfume
sexy hoe
funeral procession etiquette
rae ann london
rae ann spread
i'm a hoe mix
ba humbug sounds
birthday verses
rae-ann
folgers plant
ba humbug
bible verses for birthday
retro spanking
whisker biscuit
she's a hoe
symbolism of lemons
interesting quiz
linda carter breast implants
proper way to address the pope
american hookers hoe
persecution of christians in america
livejournal hoe of the day
corvette road trip
hoe tattoos
crack hoes gone wild
very tiny dicks
birthday proverbs from bible
cobweb weaver
smell a skunk


What kind of place does google think this is anyway? ;-)

Dear Mom,

Happy Birthday. You would have turned 64 today if you were still counting years. It's hard to believe that it's been ten years since your last real birthday. But then so much has happened that it sometimes seems longer than that. How I wish you could see your only granddaughter. She's like some kind of angel, the most beautiful girl you can imagine. I know that you had the biggest hand in that. She is everything I ever wished I could be. Thank you.

And I know you have a hand in the freaky shit that happens, like right now this song just came on the radio:

"One Sweet Day" by Mariah Carey & Boyz II Men

Sorry I never told you
All I wanted to say
And now it's too late to hold you
'Cause you've flown away
So far away

Never had I imagined
Living without your smile
Feeling and knowing you hear me
It keeps me alive
Alive

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Darling, I never showed you
Assumed you'd always be there
I took your presence for granted
But I always cared
And I miss the love we shared

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Although the sun will never shine the same
I'll always look to a brighter day
Lord I know when I lay me down to sleep
You will always listen as I pray

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Sorry I never told you
All I wanted to say

Thanks for that too.

But back to your grandchildren. The six year old, he is an adorable Wild Boy, but in the best ways. And he's so imaginative. He'll probably be a writer or a horror movie-maker. He loves going to kindergarten and is disappointed when the weekend comes.

You wouldn't believe how much the baby you knew briefly has grown up. He's almost 11 but thinks he's 30. To be fair, he's probably smarter than many 30 year olds, but emotionally he's more like 14 or 15. Some kids really do mature sooner these days. He's got (early) Beatles hair which is the current, popular style for boys, and it looks cute on him and you'd like it, I think. Within a year he'll be taller than me.

Rhonda is still the pretty one, and our difference in that regard seems to increase each year. I don't think I'm the smart one anymore. I'm not sure what I am. And sometimes I'm glad that you don't have to see how life has left its marks on me over these ten years. In some ways it is scar tissue that holds me together, so I must be thankful that it is there, whatever form it takes. You always said, "Beggars can't be choosers."

I miss you so much. I hope that Heaven is everything you hoped for, and more.

Love,
Rae Ann

Finished!

My Christmas shopping is done! If it ain't done been got, it ain't gonna get got. ;-) Not by me anyway.

Now comes the wrapping marathon. Thank God for gift bags! LOL

Merry Christmas, Happy Holidays, and Blessings to all!

Tagged!

Lubos has tagged me. Here are the rules:

Grab the book closest to you.
Open to page 123, go down to the fifth sentence.
Post the text of the next 3 sentences on your blog.
Name the book and the author.
Tag three people.

Here it is:

"We traversed the ideological line into the theater of physical causes governed by natural law where you and I are subject only to the mindless action of matter instead of being engaged in a conscious dialogue with it. The Earth-centered universe is inward-directed, which we usually characterize as closed and negative, while the heliocentric universe is outward-directed, open, and, therefore, positive. Having lived under its domain for so long, we cannot imagine what it must have been like to exist in a cosmos like Dante's - in a world that permits the human voice to penetrate to all levels of existence."

from Behind the Crystal Ball: Magic, Science, and the Occult From Antiquity Through the New Age by Anthony Aveni

I haven't read this entire book, but it does have a chapter about Richard Feynman.

I'll tag CIP, Guy the Savage Farmer, and DHammett (because he'll do it even without his own blog).

Come on, guys, you've got to play along. Even Lubos did this one!

New and Improved!

Vicious Momma and "I'm a Hoe", as well as "Lyrics of the Moment", have now been upgraded to the new Blogger which is no longer "beta." The switch was painless, though I still need to go through and label posts in various categories. Fortunately, this is something that can be done later when the holiday rush has passed.

Good News for String Theory

While looking through my kindergartener's school work last night I was pleased to find this:



Now, I'm not sure how long the concept of symmetry has been taught in kindergarten, but I do know that my 10 year old did not bring home any work like this when he was in kindergarten six years ago.

About a week ago I also saw several papers in my second grader's work that covered the concept of symmetry. I would interpret this trend as good news about the "trickle down" effect of String Theory's acceptance in a more general educational sense. Of course, String Theory did not invent Symmetry, but it has made symmetry an important foundational idea.

One Week 'Til Christmas

I borrowed this from eatmisery.

1. Eggnog or Hot chocolate?
hot chocolate

2. Does Santa wrap presents or just sit them under the tree?
some of both

3. Colored lights on tree/house or white?
both, I'm a Redneck! ;-)

4. Do you hang mistletoe?
sometimes, if someone will shoot it out of a tree. there is a lot growing in the oaks

5. When do you decorate for Christmas?
after Thanksgiving

6. What is your favorite holiday dish? (Excluding desserts!)
my sweet potato souffle that's not really a souffle

7. Favorite holiday memory as a child.
waking up ungodly early to see if Santa had come yet

8. When and how did you learn the truth about Santa?
probably around age 8 when it was thunderstorming real bad on Christmas Eve night and I knew that Sants couldn't navigate an open sled in that weather.

9. Do you open a gift on Christmas Eve?
usually

10. Do you bake cookies every year?
not recently, but this year Santa will get blackberry muffins instead of cookies because he's got to be sick of cookies by now

11. Snow? Love it or dread it?
love it but I've never had a real, true white Christmas

12. Can you ice skate?
used to

13. Do you remember your favorite gift?
age 7 I got a doll called The Littlest Angel. I just loved that doll!

14. What's your favorite thing about the holidays? What's the most
important thing about the Holidays for you?
getting to treat people with things they don't normally get; friends and family

15. Favorite holiday dessert?
pecan pie

16. What is your favorite Holiday tradition?
giving gifts

17. What is your tree topper like?
honestly, I'm not sure because the kids decorated the tree and I didn't notice the top

18. Do you like to give or receive?
Both.

19. What is your favorite Christmas carol?
"Blue Christmas" by Elvis and "Winter Wonderland" (most versions)

20. Candy canes? Yuck or Yum?
yuck, usually

21. What was the one gift you always wanted for Christmas but never got?
as a child, a Lava Lamp, but I do have one now! LOL

22. Do you buy a gift for yourself when shopping?
just something small

23. Favorite Christmas Movie?
Not sure, probably Miracle on 34th Street

24. How do you decorate your Christmas Tree?
I make the kids do it. We have lots of variety in ornaments. I like that better than a perfectly coordinated department store tree.

25. What do you do on Christmas morning?
open presents then go to grandparents' house to open more presents and eat

Quick Question

Recently there have been lots of visitors from Belgium using the search words "hoe jumpen". Is this some kind of foreign porn? LOL

Chimerical Mail Time

Hello Rae Ann,

I'm writing to express concern for your apparent instability lately. Are you okay? Are you doing everything in your power to improve the situation? Thanks.

Concerned

Dear Concerned,

Thanks for being concerned. It really helps more than you realize to know that someone actually is concerned. :-) Yes, I believe I'm on the road to recovery from a little wild roller coaster of a time. Though, it would be unrealistic to expect that things won't ever get a little crazy. That's just the way things are around here. Again, thanks for caring.

Rae Ann


Dear Rae Ann,

Inquiring minds want to know. What is your connection to Lubos Motl?

The National Enquirer

Dear National Enquirer,

Don't you usually offer people lots of money for juicy, exclusive stories? Well, sorry to disappoint you (and myself), but I can't answer that question. And the reason I can't answer it is not because my spokesperson hasn't collaborated with his spokesperson, but because that answer has not yet been defined. Sorry, inquiring minds will have to keep wanting to know. Thanks.

Rae Ann


Hi Rae Ann,

Why don't you ever post pictures of yourself? Is it because you're fat and ugly?

Anonymous

Dear Anonymous,

Well, I'm not in the habit of taking (and sharing) pictures of myself for many reasons. I'm usually the one taking the pictures of everyone else. And I've grown past that stage of needing to see myself in pictures and needing others to approve of my appearance in those pictures. And yes, I do think I'm fat and ugly, at least compared to when I was young. But I've earned the right to have a spare tire and some gray hair and wrinkles and all those other 'landmarks' of life. I've lived a lot in the last 15 years and it shows. But you know what? In the long run I think that my fat genes will prove quite beneficial and adaptive for my offspring. My kids are not fat at all, however, but they probably do carry the genes for fat storage. I think all of those super skinny people and their offspring, if they manage to have any, will die off much quicker when the New Ice Age hits. Diversity is the spice of life. Besides, it's much more sensuous to cuddy up to someone soft and warm than cold and skeletal. But I suspect you'll never have that pleasure.

Rae Ann


Dear Vicious Momma,

What is up with you and religion? Are you in or are you out?

Confused

Dear Confused,

Only God knows the secrets of my heart. ;-)

Rae Ann aka Vicious Momma

ABCs

• A-Available/Single? not single

• B-Best Friend? Ellen

• C-Cake or Pie? depends

• D-Drink Of Choice? White Russian if you mean alcohol.

• E-Essential Item You Use Everyday? toothbrush

• F-Favorite Color? I'm into yellow right now.

• G-Gummy Bears Or Worms? I hate that gummy crap.

• H-Hometown? Knoxville, TN

• I-Indulgence? long, hot baths

• J-January Or February? January.

• K-Kids & Their Names? three, but their names aren't public

• L-Life Is Incomplete Without? love

• M-Marriage Date? 5-25-1991

• N-Number Of Siblings? one sister

•O-Oranges Or Apples? apples, but orange juice

•P-Phobias/Fears? losing a loved one

• Q-Favorite Quote? When the gods want to punish you they answer your prayers. (from the movie Out of Africa)

• R-Reason to Smile? my kids

• S-Season? spring

• T-Tag Three People? not tagging anyone, but feel free

• U-Unknown Fact About Me? I can spread my toes like a monkey.

• V-Vegetable you don't like? turnip

• W-Worst Habit? I pick at my cuticles.

• X-X-rays You've Had? too many to list

• Y-Your Favorite Food? chocolate

• Z-Zodiac Sign? Aquarius

Bunch of Questions

When you looked at yourself in the mirror today, what was the first thing you thought? Yuck.

How much cash do you have on you? in my purse, about $200, but I don't usually have that much. it's Christmas money

What's a word that rhymes with DOOR? Whore

Favorite planet? other than Earth, probably Jupiter

Who is the 4th person on your missed call list on your cell phone? I don't think it goes back that far. I never get calls on it.

What is your favorite ring tone on your phone? my phone is an antique and doesn't have different ring tones

What shirt are you wearing? old Body Glove t-shirt

Do you label yourself? sometimes

Name the brand of the shoes you're currently wearing? MIA

Bright or Dark Room? depends on what I'm doing

What do you think about the person who took this survey before you? she's pretty cool!

What does your watch look like? I don't wear a watch

What were you doing at midnight last night? sleeping

What did your last text message you received on your cell say? I don't get text messages. Nobody cares about me. :-(

Where is your nearest 7-11? we don't have them here

What's a word that you say a lot? really

Who told you he/she loved you last? my daughter

Last furry thing you touched? My dog.

How many drugs have you done in the last three days? hehehe, I take my prescription every day.

How many rolls of film do you need developed? one or two probably

Favorite age you have been so far? honestly, probably 18-21. Too young to know and too stupid to care.

Your worst enemy? myself

What is your current desktop picture? the Corvette

What was the last thing you said to someone? Be careful.

If you had to choose between a million bucks or to be able to fly what would it be? fly

Do you like someone? "like" as in "like"? Or "like" as in "would like to get to know better"? Well, yes, on both counts.

The last song you listened to? some 80's power ballad on the radio after dropping of the kids

What time of day were you born? 4:57 am

What's your favorite number? 25

Where did you live in 1987? partly at Maryville College, partly at Marietta, GA

Are you jealous of anyone? not jealous, really

Is anyone jealous of you? don't know

Where were you when 9/11 happened? in my living room watching it happen on TV

What do you do when vending machines steal your money? sometimes kick it if no one is around

Do you consider yourself kind? usually

If you had to get a tattoo, where would it be? I don't know. that's why I've never gotten one.

If you could be fluent in any other language, what would it be? physics ;-)

Would you move for the person you loved? well, been there, done that.

Are you touchy feely? depends

What's your life motto? If you can't laugh about it you're screwed.

Name three things that you have on you at all times? I don't have things on me at all times.

What's your favourite town/city? I don't know.

What was the last thing you paid for with cash? Some Christmas gifts at Target yesterday.

When was the last time you wrote a letter to someone on paper and mailed it? several years

Can you change the oil on a car? Probably, but that's a man's job.

Your first love: what is the last thing you heard about him or her? wow, I haven't heard anything

How far back do you know about your ancestry? Most sides of the family have someone who does geneology so they've gone back to the 1600s in America.

The last time you dressed fancy, what did you wear and why did you dress fancy? I can't remember the last time I dressed fancy.

Does anything hurt on your body right now? fortunately, no

Have you been burned by love? Who hasn't?

TMI Tuesday Sermonette

warning: for those who are very sensitive, please know that this post contains potentially blasphemous and shocking statements

Yes, this is Wednesday, but I started this last night so the title stands.

The other night I was thinking about why this time of year is so difficult and this thought occurred to me. God-centered religion has really harmed women a lot over the ages and it becomes most apparent at this time of year.

Christmas is the celebration of Christ's birth. We celebrate the arrival of the baby. But somehow it is ignored that birth also involves a woman. Well, you can't give birth to anyone without a mother. The Protestants, especially Fundamentalists, completely ignore that messiness of birth in their celebrations. Well, I've got news for them:

Jesus came out of Mary's VAGINA!

(I was wallowing in my misery, and by God, I think I found a little bit of my missing humor. Sometimes you have to get real cozy and familiar with your misery so you'll learn something from it. Hell, just dive into it and swim. You might find some of those things that sank to the bottom and were lost. Sometimes I dream that I can breathe under water. It's weird, but cool.)

Okay, so Christmas is as much a mother's holiday as anything else, whether you like to admit it or not. And we all know that in most families it is the mother who assures that Christmas happens at all. We do most of the shopping, decorating, and all that. It's a lot of work that goes mostly unnoticed and unappreciated, unless there is some disaster and someone doesn't get what they asked for. Well, then, it's all Mom's fault for not finding it, and never mind all the other crap she did get you. This is what happens when you take the mother out of birth and just celebrate the child. The children get spoiled! And the mothers become downtrodden.

People say, "Jesus is the Reason for the Season." Well, sure, but he wouldn't have gotten here without his mother. Someone should invent a new slogan for the holiday that celebrates Motherhood and the pains that mothers go through to bring their children into the world and also the pains that mothers go through to make their children happy. Sorry, I'm not feeling especially inventive right now. If it were up to me the new slogan would be "Jesus came from Mary's vagina." But I really don't think that will catch on too well.

Now, before any self-righteous nincompoop gets their panties or boxers or briefs or whatever in a wad, just consider this: Ten years ago my mother was dying - wasting away with cancer during that holiday season. The tenth anniversary of her death is just a few days after Christmas. So allow me a little expression of mourning and if that expression takes the form of blasphemy I think God will forgive me whether anyone else will or not. And that's the point of Jesus coming out of Mary's vagina in the first place, right?

So I miss my mother and it's very sad to me that two of my children never met her and will only know her from pictures and stories. It really kind of SUCKS. And the holiday season which is as much a reminder of motherhood as you can invent is pretty painful for me. I don't expect anyone else to really understand because you can't until you've lost your own mother, but maybe if anyone actually reads this they'll see the holiday with a new perspective and appreciation for the women who keep the holidays coming every year.

And you know what, we all came out of our mothers' vaginas. Well, except for those who were born via c-section, like my children. But still they came out of my body. Maybe that new slogan could be something like "Jesus came from Mary's belly." Yeah, that's not so bad.

And that is this week's sermonette. Hey, many churches have Wednesday night services, so there you go.

Ba Humbug

I'm sorry to report that I have no Christmas spirit this year. It has apparently been sucked into the same black hole that has absorbed my sense of humor and equilibrium. I hope that the universe on the other side is enjoying its newly acquired assets. Perhaps that is all it needed to invent life for itself. Well, I hope it enjoys it while it lasts, which probably won't be too long. Just ask the gorillas. ;-)

Everyone have a wonderful Christmas. I won't be around much, if at all. Sorry.

Hard Hearted?

Gorillas are dying and could end up extinct soon if ebola and hunting continue. Well, the hunting is one thing, but the ebola is quite another. Now, I don't mean to sound very hard hearted, but shouldn't we let Nature take its course if there is a disease that is eliminating an evolutionary dead end? How many species of primates have gone extinct so far? Is it really in the best interest of the planet to try to "save" every species that has probably lived out its course of life here? Perhaps it's in the best interest of the planet to let the gorillas die off and maybe the ebola virus with them? It is believed that humans contract ebola from the gorillas. Well, don't we kill off cows that have mad cow disease to keep it from spreading? And don't we kill off birds that carry the bird flu? Are we not supposed to protect our own population from real threats such as ebola, or is it more important to cut our CO2 emmissions? If you ask me I think ebola is much more threatening to human life (and that of other animals) than some mythical global warming. Sure, sometimes we like gorillas more than cows and birds because we think they are more like us. But how much like us are they really? I don't know the genetic information on that and I'm not looking it up right now.

Well, this isn't a Sunday Sermonette, not yet anyway. I might modify it later. ;-)

Friday Five

1. Are you complicated?

Probably not as much as I think I am. ;-)

2. Do you retaliate?

I fantasize about it.

3. Last person to hug you?

My oldest son. He had a rough day.

4. Your latest complaint:

I'm tired of being human.

5. Who was the bully on your playground?

Some people might answer that with my name. ;-)

Random Transcendentalism

Cell Division
Magnetism

The religion that is afraid of science dishonors God and commits suicide . . .

Standing on the bare ground, my head bathed by the blithe air, and uplifted into infinite space, all mean egotism vanishes. I become a transparent eyeball. I am nothing; I see all; the currents of the Universal Being circulate through me. I am part or particle of God . . .

There is no screen or ceiling between our heads and the infinite heavens . . . no bar or wall in the soul where we, the effect, cease, and God, the cause, begins.

Ralph Waldo Emerson, various essays

I believe in the flesh and the appetites; Seeing, hearing, feeling, are miracles, and each part and tag of me is a miracle.
Divine am I inside and out, and I make holy whatever I touch and am touch’d from;

Walt Whitman, "Leaves of Grass"

Circular Crops

I'm Ready

(this picture doesn't have anything to do with anything; I just wanted to put a picture in this post)


Take me to the Stepfordizer. I've decided that I just really don't like being human. There are just too many discomforts and other hassles. Come to think about it, I've never really liked being human. I must have done something terrible in my past lives. ;-) Can I be a robot instead of a human now?

Fortune Cookie

make your own fortune cookie

DNA Message

AGAATGTAGGGCTAAGCGCTGATGGTACTTCGTGCGGCGT
CAATGGCGGATGCCCTTATGGTTGGCATGGTCCGTTCAATGGTCG
GCGCTCTTGTTGAGGATGGAGACATGTACCTTGTATCAATGCTG
GATGTAGTTTCAATGCTATAAGTTATGAGAGCGGCGATGCT
TTATCTTGTACTCGATGTCCTTATGGTCGGCGCTCTTATGGTCCTTG
CGGAAATGCTCGGCGGAGTTGTAGGCGCGATGGTTGAG
GATGTCATGGTTGATGCTCTTGTG

(I had to break it up into several lines so it would fit on the page. To decode it you'll have to return it to a whole, long string.)


Create and decode a message in DNA.

What People Are Looking For

It's interesting to note the search terms that bring people here. Currently, the most popular searches are for "birthday verses" which lands people here.

TMI Tuesday

Because I'm lacking the time and imagination to come up with my own ideas this week, I'm borrowing an idea from here, a blog devoted to TMI Tuesday memes.


1. My biggest sexual turn on is __________?

kissing

2. On a scale of 1-10, how jealous do you get (have you gotten)?

been to 10 a few times

3. Have you ever had sex with someone you work(ed) with? Any negative consequences?

yes, no

4. Wash up, cuddle or fall asleep?

depends on many factors

5. Which is more important of the two in "chemistry," physical attractiveness or sexual performance?

performance

6. Do you regret any past sexual partner, sexual liaison, or missed opportunity for one?

yes, yes, and yes

7. Have you had sex with a virgin after you lost your virginity?

yes, but he was older than me (at least he told me he was a virgin)

8. What is your favorite sexual position? If different, which one do you enjoy the most?

well, that is definitely too much information

Bonus (as in optional): What kind of birth control do you use?

sterilization, 100% effective

Close Enough for Rock 'n' Roll

Jesus quote generator

Please don't crucify me!