Retrospection, 2006

So many things have happened this year, even if only in my mind ;-), that I can't possibly summarize it into a few paragraphs. It's just beyond my ability. So maybe I'll just pick and choose. ;-)

While thinking about 2006 the first thoughts were that it was the Year of Giving Until It Hurts. I know I've expressed this idea in other posts throughout the year, but I don't have time to go back and link them at the moment. I let myself feel the emotions of self sacrifice (and even some resentment) while recalling all the times I gave until it hurt. Then I was so overcome, to the point of tears, with the realization that I am so extremely Blessed in this life that the whole meaning of The Year of Giving Until It Hurts was transformed into something else, something Divine*. It wasn't only my giving. I've received so much that I have no right or privilege to complain about anything when it comes to my family life. And I am so very thankful for all of my Blessings. It is pleasantly humbling (like a "good hurt") to realize the magnitude of it.

So while I might feel like a doormat in some respects I also now know that I've got to be a really large, durable, and probably comforting doormat to be able to handle all the trampling of this past year. ;-) Perhaps I'm flirting with a Job kind of moment right now in that it's better to be thankful for all the good things in life instead of focusing on what was lost, taken away, or not given at all.

Oh, yeah, the Lemon Tree. For the ongoing lemon tree saga: critter updates, tree of life, tree of life update, waiting, and signs, etc.

I'm still waiting to squeeze those lemons. ;-) But the tree is blooming again! (sorry for the poor quality photo)



And this time there are at least four times as many flowers (many not visible in that photo). Since there are no bees or other bugs I don't know if there will be fruit from these blooms. If the tree self-pollinates maybe there will be. It apparently doesn't get enough light right now to fully ripen the fruit already on it. Well even so, I think I'll ring in the New Year with a glass of premature lemonade. What better way to celebrate this passing year and all of it's sweet and sour moments? After all, even though I hated the poster my college roommate hung on our wall I guess it convinced me anyway that when life gives you lemons, even half-ripe lemons, make the best of it and make lemonade!

So cheers to all and here's to celebrating and being thankful for 2006! And cheers to all and here's to a sweeter and less sour 2007!

Therefore encourage one another and build up one another, just as you also are doing. But we request of you, brethren, that you appreciate those who diligently labor among you, and have charge over you in the Lord and give you instruction; and that you esteem them very highly in love because of their work. Live in peace with one another. We urge you, brethren, admonish the unruly, encourage the fainthearted, help the weak, be patient with everyone. See that no one repays another with evil for evil, but always seek after that which is good for one another and for all people. Rejoice always; pray without ceasing; in everything give thanks...

1 Thessalonians 5: 11-18
New American Standard version

And that is this year's final Sunday Sermonette. Happy New Year!


Retrospection, 2005


---------------------------
* I'm truly sorry for those who cannot experience the Divine in that way. I think that part of the reason why some people refuse to acknowledge the Divine is because it is a kind of painful experience. It does hurt a little at first (just like some other things), but the feeling changes to a kind of rapture (just like some other things). Some people fear that initial pain so much that they won't even approach it. Well, as they say, what you don't know can't hurt you. But they also say, you never know until you try. Let me tell you, the more humble you are the less it hurts to be put in your place.

Christmas Pics

Prettiest girl in the world.


Cutest boys in the world.


Cute green bean bundles my dad made for Christmas Eve dinner.

Because I need a good laugh...

Most recent search terms that brought people here:

jose can you see magazine article title
corvette frame
movie quote: when i was younger, i used 2 think about it a lot and envision how it may have happened....
hoe much does a kitten cost
gay mechanics
bratx dolls
zz top i like your peaches
blanket fetish
what were you doing at midnight survey
hoe movie
slept with my boss married
shasta porn
shine on me dressbarn perfume
sexy hoe
funeral procession etiquette
rae ann london
rae ann spread
i'm a hoe mix
ba humbug sounds
birthday verses
rae-ann
folgers plant
ba humbug
bible verses for birthday
retro spanking
whisker biscuit
she's a hoe
symbolism of lemons
interesting quiz
linda carter breast implants
proper way to address the pope
american hookers hoe
persecution of christians in america
livejournal hoe of the day
corvette road trip
hoe tattoos
crack hoes gone wild
very tiny dicks
birthday proverbs from bible
cobweb weaver
smell a skunk


What kind of place does google think this is anyway? ;-)

Dear Mom,

Happy Birthday. You would have turned 64 today if you were still counting years. It's hard to believe that it's been ten years since your last real birthday. But then so much has happened that it sometimes seems longer than that. How I wish you could see your only granddaughter. She's like some kind of angel, the most beautiful girl you can imagine. I know that you had the biggest hand in that. She is everything I ever wished I could be. Thank you.

And I know you have a hand in the freaky shit that happens, like right now this song just came on the radio:

"One Sweet Day" by Mariah Carey & Boyz II Men

Sorry I never told you
All I wanted to say
And now it's too late to hold you
'Cause you've flown away
So far away

Never had I imagined
Living without your smile
Feeling and knowing you hear me
It keeps me alive
Alive

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Darling, I never showed you
Assumed you'd always be there
I took your presence for granted
But I always cared
And I miss the love we shared

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Although the sun will never shine the same
I'll always look to a brighter day
Lord I know when I lay me down to sleep
You will always listen as I pray

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

And I know you're shining down on me from Heaven
Like so many friends we've lost along the way
And I know eventually we'll be together
One sweet day

Sorry I never told you
All I wanted to say

Thanks for that too.

But back to your grandchildren. The six year old, he is an adorable Wild Boy, but in the best ways. And he's so imaginative. He'll probably be a writer or a horror movie-maker. He loves going to kindergarten and is disappointed when the weekend comes.

You wouldn't believe how much the baby you knew briefly has grown up. He's almost 11 but thinks he's 30. To be fair, he's probably smarter than many 30 year olds, but emotionally he's more like 14 or 15. Some kids really do mature sooner these days. He's got (early) Beatles hair which is the current, popular style for boys, and it looks cute on him and you'd like it, I think. Within a year he'll be taller than me.

Rhonda is still the pretty one, and our difference in that regard seems to increase each year. I don't think I'm the smart one anymore. I'm not sure what I am. And sometimes I'm glad that you don't have to see how life has left its marks on me over these ten years. In some ways it is scar tissue that holds me together, so I must be thankful that it is there, whatever form it takes. You always said, "Beggars can't be choosers."

I miss you so much. I hope that Heaven is everything you hoped for, and more.

Love,
Rae Ann

Finished!

My Christmas shopping is done! If it ain't done been got, it ain't gonna get got. ;-) Not by me anyway.

Now comes the wrapping marathon. Thank God for gift bags! LOL

Merry Christmas, Happy Holidays, and Blessings to all!

Tagged!

Lubos has tagged me. Here are the rules:

Grab the book closest to you.
Open to page 123, go down to the fifth sentence.
Post the text of the next 3 sentences on your blog.
Name the book and the author.
Tag three people.

Here it is:

"We traversed the ideological line into the theater of physical causes governed by natural law where you and I are subject only to the mindless action of matter instead of being engaged in a conscious dialogue with it. The Earth-centered universe is inward-directed, which we usually characterize as closed and negative, while the heliocentric universe is outward-directed, open, and, therefore, positive. Having lived under its domain for so long, we cannot imagine what it must have been like to exist in a cosmos like Dante's - in a world that permits the human voice to penetrate to all levels of existence."

from Behind the Crystal Ball: Magic, Science, and the Occult From Antiquity Through the New Age by Anthony Aveni

I haven't read this entire book, but it does have a chapter about Richard Feynman.

I'll tag CIP, Guy the Savage Farmer, and DHammett (because he'll do it even without his own blog).

Come on, guys, you've got to play along. Even Lubos did this one!

New and Improved!

Vicious Momma and "I'm a Hoe", as well as "Lyrics of the Moment", have now been upgraded to the new Blogger which is no longer "beta." The switch was painless, though I still need to go through and label posts in various categories. Fortunately, this is something that can be done later when the holiday rush has passed.

Good News for String Theory

While looking through my kindergartener's school work last night I was pleased to find this:



Now, I'm not sure how long the concept of symmetry has been taught in kindergarten, but I do know that my 10 year old did not bring home any work like this when he was in kindergarten six years ago.

About a week ago I also saw several papers in my second grader's work that covered the concept of symmetry. I would interpret this trend as good news about the "trickle down" effect of String Theory's acceptance in a more general educational sense. Of course, String Theory did not invent Symmetry, but it has made symmetry an important foundational idea.

One Week 'Til Christmas

I borrowed this from eatmisery.

1. Eggnog or Hot chocolate?
hot chocolate

2. Does Santa wrap presents or just sit them under the tree?
some of both

3. Colored lights on tree/house or white?
both, I'm a Redneck! ;-)

4. Do you hang mistletoe?
sometimes, if someone will shoot it out of a tree. there is a lot growing in the oaks

5. When do you decorate for Christmas?
after Thanksgiving

6. What is your favorite holiday dish? (Excluding desserts!)
my sweet potato souffle that's not really a souffle

7. Favorite holiday memory as a child.
waking up ungodly early to see if Santa had come yet

8. When and how did you learn the truth about Santa?
probably around age 8 when it was thunderstorming real bad on Christmas Eve night and I knew that Sants couldn't navigate an open sled in that weather.

9. Do you open a gift on Christmas Eve?
usually

10. Do you bake cookies every year?
not recently, but this year Santa will get blackberry muffins instead of cookies because he's got to be sick of cookies by now

11. Snow? Love it or dread it?
love it but I've never had a real, true white Christmas

12. Can you ice skate?
used to

13. Do you remember your favorite gift?
age 7 I got a doll called The Littlest Angel. I just loved that doll!

14. What's your favorite thing about the holidays? What's the most
important thing about the Holidays for you?
getting to treat people with things they don't normally get; friends and family

15. Favorite holiday dessert?
pecan pie

16. What is your favorite Holiday tradition?
giving gifts

17. What is your tree topper like?
honestly, I'm not sure because the kids decorated the tree and I didn't notice the top

18. Do you like to give or receive?
Both.

19. What is your favorite Christmas carol?
"Blue Christmas" by Elvis and "Winter Wonderland" (most versions)

20. Candy canes? Yuck or Yum?
yuck, usually

21. What was the one gift you always wanted for Christmas but never got?
as a child, a Lava Lamp, but I do have one now! LOL

22. Do you buy a gift for yourself when shopping?
just something small

23. Favorite Christmas Movie?
Not sure, probably Miracle on 34th Street

24. How do you decorate your Christmas Tree?
I make the kids do it. We have lots of variety in ornaments. I like that better than a perfectly coordinated department store tree.

25. What do you do on Christmas morning?
open presents then go to grandparents' house to open more presents and eat

Quick Question

Recently there have been lots of visitors from Belgium using the search words "hoe jumpen". Is this some kind of foreign porn? LOL

Chimerical Mail Time

Hello Rae Ann,

I'm writing to express concern for your apparent instability lately. Are you okay? Are you doing everything in your power to improve the situation? Thanks.

Concerned

Dear Concerned,

Thanks for being concerned. It really helps more than you realize to know that someone actually is concerned. :-) Yes, I believe I'm on the road to recovery from a little wild roller coaster of a time. Though, it would be unrealistic to expect that things won't ever get a little crazy. That's just the way things are around here. Again, thanks for caring.

Rae Ann


Dear Rae Ann,

Inquiring minds want to know. What is your connection to Lubos Motl?

The National Enquirer

Dear National Enquirer,

Don't you usually offer people lots of money for juicy, exclusive stories? Well, sorry to disappoint you (and myself), but I can't answer that question. And the reason I can't answer it is not because my spokesperson hasn't collaborated with his spokesperson, but because that answer has not yet been defined. Sorry, inquiring minds will have to keep wanting to know. Thanks.

Rae Ann


Hi Rae Ann,

Why don't you ever post pictures of yourself? Is it because you're fat and ugly?

Anonymous

Dear Anonymous,

Well, I'm not in the habit of taking (and sharing) pictures of myself for many reasons. I'm usually the one taking the pictures of everyone else. And I've grown past that stage of needing to see myself in pictures and needing others to approve of my appearance in those pictures. And yes, I do think I'm fat and ugly, at least compared to when I was young. But I've earned the right to have a spare tire and some gray hair and wrinkles and all those other 'landmarks' of life. I've lived a lot in the last 15 years and it shows. But you know what? In the long run I think that my fat genes will prove quite beneficial and adaptive for my offspring. My kids are not fat at all, however, but they probably do carry the genes for fat storage. I think all of those super skinny people and their offspring, if they manage to have any, will die off much quicker when the New Ice Age hits. Diversity is the spice of life. Besides, it's much more sensuous to cuddy up to someone soft and warm than cold and skeletal. But I suspect you'll never have that pleasure.

Rae Ann


Dear Vicious Momma,

What is up with you and religion? Are you in or are you out?

Confused

Dear Confused,

Only God knows the secrets of my heart. ;-)

Rae Ann aka Vicious Momma

ABCs

• A-Available/Single? not single

• B-Best Friend? Ellen

• C-Cake or Pie? depends

• D-Drink Of Choice? White Russian if you mean alcohol.

• E-Essential Item You Use Everyday? toothbrush

• F-Favorite Color? I'm into yellow right now.

• G-Gummy Bears Or Worms? I hate that gummy crap.

• H-Hometown? Knoxville, TN

• I-Indulgence? long, hot baths

• J-January Or February? January.

• K-Kids & Their Names? three, but their names aren't public

• L-Life Is Incomplete Without? love

• M-Marriage Date? 5-25-1991

• N-Number Of Siblings? one sister

•O-Oranges Or Apples? apples, but orange juice

•P-Phobias/Fears? losing a loved one

• Q-Favorite Quote? When the gods want to punish you they answer your prayers. (from the movie Out of Africa)

• R-Reason to Smile? my kids

• S-Season? spring

• T-Tag Three People? not tagging anyone, but feel free

• U-Unknown Fact About Me? I can spread my toes like a monkey.

• V-Vegetable you don't like? turnip

• W-Worst Habit? I pick at my cuticles.

• X-X-rays You've Had? too many to list

• Y-Your Favorite Food? chocolate

• Z-Zodiac Sign? Aquarius

Bunch of Questions

When you looked at yourself in the mirror today, what was the first thing you thought? Yuck.

How much cash do you have on you? in my purse, about $200, but I don't usually have that much. it's Christmas money

What's a word that rhymes with DOOR? Whore

Favorite planet? other than Earth, probably Jupiter

Who is the 4th person on your missed call list on your cell phone? I don't think it goes back that far. I never get calls on it.

What is your favorite ring tone on your phone? my phone is an antique and doesn't have different ring tones

What shirt are you wearing? old Body Glove t-shirt

Do you label yourself? sometimes

Name the brand of the shoes you're currently wearing? MIA

Bright or Dark Room? depends on what I'm doing

What do you think about the person who took this survey before you? she's pretty cool!

What does your watch look like? I don't wear a watch

What were you doing at midnight last night? sleeping

What did your last text message you received on your cell say? I don't get text messages. Nobody cares about me. :-(

Where is your nearest 7-11? we don't have them here

What's a word that you say a lot? really

Who told you he/she loved you last? my daughter

Last furry thing you touched? My dog.

How many drugs have you done in the last three days? hehehe, I take my prescription every day.

How many rolls of film do you need developed? one or two probably

Favorite age you have been so far? honestly, probably 18-21. Too young to know and too stupid to care.

Your worst enemy? myself

What is your current desktop picture? the Corvette

What was the last thing you said to someone? Be careful.

If you had to choose between a million bucks or to be able to fly what would it be? fly

Do you like someone? "like" as in "like"? Or "like" as in "would like to get to know better"? Well, yes, on both counts.

The last song you listened to? some 80's power ballad on the radio after dropping of the kids

What time of day were you born? 4:57 am

What's your favorite number? 25

Where did you live in 1987? partly at Maryville College, partly at Marietta, GA

Are you jealous of anyone? not jealous, really

Is anyone jealous of you? don't know

Where were you when 9/11 happened? in my living room watching it happen on TV

What do you do when vending machines steal your money? sometimes kick it if no one is around

Do you consider yourself kind? usually

If you had to get a tattoo, where would it be? I don't know. that's why I've never gotten one.

If you could be fluent in any other language, what would it be? physics ;-)

Would you move for the person you loved? well, been there, done that.

Are you touchy feely? depends

What's your life motto? If you can't laugh about it you're screwed.

Name three things that you have on you at all times? I don't have things on me at all times.

What's your favourite town/city? I don't know.

What was the last thing you paid for with cash? Some Christmas gifts at Target yesterday.

When was the last time you wrote a letter to someone on paper and mailed it? several years

Can you change the oil on a car? Probably, but that's a man's job.

Your first love: what is the last thing you heard about him or her? wow, I haven't heard anything

How far back do you know about your ancestry? Most sides of the family have someone who does geneology so they've gone back to the 1600s in America.

The last time you dressed fancy, what did you wear and why did you dress fancy? I can't remember the last time I dressed fancy.

Does anything hurt on your body right now? fortunately, no

Have you been burned by love? Who hasn't?

TMI Tuesday Sermonette

warning: for those who are very sensitive, please know that this post contains potentially blasphemous and shocking statements

Yes, this is Wednesday, but I started this last night so the title stands.

The other night I was thinking about why this time of year is so difficult and this thought occurred to me. God-centered religion has really harmed women a lot over the ages and it becomes most apparent at this time of year.

Christmas is the celebration of Christ's birth. We celebrate the arrival of the baby. But somehow it is ignored that birth also involves a woman. Well, you can't give birth to anyone without a mother. The Protestants, especially Fundamentalists, completely ignore that messiness of birth in their celebrations. Well, I've got news for them:

Jesus came out of Mary's VAGINA!

(I was wallowing in my misery, and by God, I think I found a little bit of my missing humor. Sometimes you have to get real cozy and familiar with your misery so you'll learn something from it. Hell, just dive into it and swim. You might find some of those things that sank to the bottom and were lost. Sometimes I dream that I can breathe under water. It's weird, but cool.)

Okay, so Christmas is as much a mother's holiday as anything else, whether you like to admit it or not. And we all know that in most families it is the mother who assures that Christmas happens at all. We do most of the shopping, decorating, and all that. It's a lot of work that goes mostly unnoticed and unappreciated, unless there is some disaster and someone doesn't get what they asked for. Well, then, it's all Mom's fault for not finding it, and never mind all the other crap she did get you. This is what happens when you take the mother out of birth and just celebrate the child. The children get spoiled! And the mothers become downtrodden.

People say, "Jesus is the Reason for the Season." Well, sure, but he wouldn't have gotten here without his mother. Someone should invent a new slogan for the holiday that celebrates Motherhood and the pains that mothers go through to bring their children into the world and also the pains that mothers go through to make their children happy. Sorry, I'm not feeling especially inventive right now. If it were up to me the new slogan would be "Jesus came from Mary's vagina." But I really don't think that will catch on too well.

Now, before any self-righteous nincompoop gets their panties or boxers or briefs or whatever in a wad, just consider this: Ten years ago my mother was dying - wasting away with cancer during that holiday season. The tenth anniversary of her death is just a few days after Christmas. So allow me a little expression of mourning and if that expression takes the form of blasphemy I think God will forgive me whether anyone else will or not. And that's the point of Jesus coming out of Mary's vagina in the first place, right?

So I miss my mother and it's very sad to me that two of my children never met her and will only know her from pictures and stories. It really kind of SUCKS. And the holiday season which is as much a reminder of motherhood as you can invent is pretty painful for me. I don't expect anyone else to really understand because you can't until you've lost your own mother, but maybe if anyone actually reads this they'll see the holiday with a new perspective and appreciation for the women who keep the holidays coming every year.

And you know what, we all came out of our mothers' vaginas. Well, except for those who were born via c-section, like my children. But still they came out of my body. Maybe that new slogan could be something like "Jesus came from Mary's belly." Yeah, that's not so bad.

And that is this week's sermonette. Hey, many churches have Wednesday night services, so there you go.

Ba Humbug

I'm sorry to report that I have no Christmas spirit this year. It has apparently been sucked into the same black hole that has absorbed my sense of humor and equilibrium. I hope that the universe on the other side is enjoying its newly acquired assets. Perhaps that is all it needed to invent life for itself. Well, I hope it enjoys it while it lasts, which probably won't be too long. Just ask the gorillas. ;-)

Everyone have a wonderful Christmas. I won't be around much, if at all. Sorry.

Hard Hearted?

Gorillas are dying and could end up extinct soon if ebola and hunting continue. Well, the hunting is one thing, but the ebola is quite another. Now, I don't mean to sound very hard hearted, but shouldn't we let Nature take its course if there is a disease that is eliminating an evolutionary dead end? How many species of primates have gone extinct so far? Is it really in the best interest of the planet to try to "save" every species that has probably lived out its course of life here? Perhaps it's in the best interest of the planet to let the gorillas die off and maybe the ebola virus with them? It is believed that humans contract ebola from the gorillas. Well, don't we kill off cows that have mad cow disease to keep it from spreading? And don't we kill off birds that carry the bird flu? Are we not supposed to protect our own population from real threats such as ebola, or is it more important to cut our CO2 emmissions? If you ask me I think ebola is much more threatening to human life (and that of other animals) than some mythical global warming. Sure, sometimes we like gorillas more than cows and birds because we think they are more like us. But how much like us are they really? I don't know the genetic information on that and I'm not looking it up right now.

Well, this isn't a Sunday Sermonette, not yet anyway. I might modify it later. ;-)

Friday Five

1. Are you complicated?

Probably not as much as I think I am. ;-)

2. Do you retaliate?

I fantasize about it.

3. Last person to hug you?

My oldest son. He had a rough day.

4. Your latest complaint:

I'm tired of being human.

5. Who was the bully on your playground?

Some people might answer that with my name. ;-)

Random Transcendentalism

Cell Division
Magnetism

The religion that is afraid of science dishonors God and commits suicide . . .

Standing on the bare ground, my head bathed by the blithe air, and uplifted into infinite space, all mean egotism vanishes. I become a transparent eyeball. I am nothing; I see all; the currents of the Universal Being circulate through me. I am part or particle of God . . .

There is no screen or ceiling between our heads and the infinite heavens . . . no bar or wall in the soul where we, the effect, cease, and God, the cause, begins.

Ralph Waldo Emerson, various essays

I believe in the flesh and the appetites; Seeing, hearing, feeling, are miracles, and each part and tag of me is a miracle.
Divine am I inside and out, and I make holy whatever I touch and am touch’d from;

Walt Whitman, "Leaves of Grass"

Circular Crops

I'm Ready

(this picture doesn't have anything to do with anything; I just wanted to put a picture in this post)


Take me to the Stepfordizer. I've decided that I just really don't like being human. There are just too many discomforts and other hassles. Come to think about it, I've never really liked being human. I must have done something terrible in my past lives. ;-) Can I be a robot instead of a human now?

Fortune Cookie

make your own fortune cookie

DNA Message

AGAATGTAGGGCTAAGCGCTGATGGTACTTCGTGCGGCGT
CAATGGCGGATGCCCTTATGGTTGGCATGGTCCGTTCAATGGTCG
GCGCTCTTGTTGAGGATGGAGACATGTACCTTGTATCAATGCTG
GATGTAGTTTCAATGCTATAAGTTATGAGAGCGGCGATGCT
TTATCTTGTACTCGATGTCCTTATGGTCGGCGCTCTTATGGTCCTTG
CGGAAATGCTCGGCGGAGTTGTAGGCGCGATGGTTGAG
GATGTCATGGTTGATGCTCTTGTG

(I had to break it up into several lines so it would fit on the page. To decode it you'll have to return it to a whole, long string.)


Create and decode a message in DNA.

What People Are Looking For

It's interesting to note the search terms that bring people here. Currently, the most popular searches are for "birthday verses" which lands people here.

TMI Tuesday

Because I'm lacking the time and imagination to come up with my own ideas this week, I'm borrowing an idea from here, a blog devoted to TMI Tuesday memes.


1. My biggest sexual turn on is __________?

kissing

2. On a scale of 1-10, how jealous do you get (have you gotten)?

been to 10 a few times

3. Have you ever had sex with someone you work(ed) with? Any negative consequences?

yes, no

4. Wash up, cuddle or fall asleep?

depends on many factors

5. Which is more important of the two in "chemistry," physical attractiveness or sexual performance?

performance

6. Do you regret any past sexual partner, sexual liaison, or missed opportunity for one?

yes, yes, and yes

7. Have you had sex with a virgin after you lost your virginity?

yes, but he was older than me (at least he told me he was a virgin)

8. What is your favorite sexual position? If different, which one do you enjoy the most?

well, that is definitely too much information

Bonus (as in optional): What kind of birth control do you use?

sterilization, 100% effective

Close Enough for Rock 'n' Roll

Jesus quote generator

Please don't crucify me!